Description :
From Genome Similarity Track
Location :
scaffold_5:950700- 953168
Sequence
2468 bases(100 bases per row)
CGCGACGCATATCAATTATTCTCAGGAGTCCGCACGATTCCTATTTCGCTCTTTTGTGCAAGTGCACGTCAACGTGTTTGAGCCCGGAGCTCCCACAAAA
CCTTCAGCCAGATCGTGGTATACGACACAAGATTGAGATTGAGCCAGATGCAGAATATATGCTATTGCGTCAATGGCTATCACCAGCTGAGCAATCCGAG
ATTATAGATTCGTTCTTTGCTGCTAAACAGCAAAATGGGAAGGTGAGAGGAAGTCAATATCCCTACAGTGCGCCGATGTCTTGCGCTCGCATATTCAATA
GCAAGTGACGCATTGTACACGCATACAGCAAGTTTAACGCCAAACCTGTGCGGGCCCAGACCCCTATTCCTTGCAACGATGCCATTATCAACAAGATGAC
TGGCTCAAAACGCCTTTTTAGCATACCTGATGTAGTGGATGGCTTTTATCAAGATTTAATGGATCCTTGATACAGCAGTGAGCACACCTAGCGGTATGCT
TTGGAAATGGCTTATGATGCCACAAGGACTCTCCAACGCGGCAGCAAAGTTTAACTGTCTCGTTTCGCACTTGTTCCTTCCATTGCGATTATTTGCGTCG
ACGTATTTCGATGACATCCTTGTCCATTTAAAACAGGAAAACAGGCCGATCTATCGATCTAATTCATCTCGAGCACCTGGAACAGGTGTTGGCCTGTAGG
ACAGAACATCAGCTCTTTGCCAGCATAGATATATATTCGGCGCCGAAAAGTATTAGTTTTGTGCTGTTCTGTTGGCGTCGACGGTTTTTAGGTAGGCCCA
GCGAAGCTCAAAGCGATCTTAGAATGAGCCGACGTCAATAATCCAGAAGGATCTGAGGAAAGTGTTGGGTCTGGTCAAGTATTTCCATCGGTATACTTAA
AATtatgccgacatggcacggCCGTTATCGGACTTGTTATAAAGATCAAGAGTGCTCATAAAAAATTGGATGTGCAGAATTTTAACGAAATCAAGCACAG
CTTGCAGGCAACACCAATATTACGCCTTCGACTTTGCAATCGAATGTGCATTGTTGCAGCAAGATGTTAATGTGCAAGAACATATCATCTCGCATCAGTC
GAGTCAGCTGGAGACAGCTAAACGTAATTATCCCGTTCACTTTAAATCATTGTTAGCAATTAAATATGCTTTGGTGAAGTTTGGGGCTCGCCTCTTGTGA
TCCAAGCTATTAGTCATTTTTCCGCACAACGCTCGCTGCATACACCGACTCAAACGCCACAATTGTCACAGCGAATGTCCCTTTAGTTGTCGCACTTTTC
AGAATTCAACTTAGCAGTGGCATATAAGCCAGGCAAATGGAGTGTTTTGACGGATGCCTATCATACGTTATCCGTGATTCCGCAATACTTCCAGTATGCT
CGACATGATACAGCAAGCGTATCCAGACGACCCAGCTAGAGCTGTTACTTTTAAGTGGTTGACAACTATTCATAAATCAGTCTGAACGTCATTATCTCCG
CGAGTTCGCGGTCAAACTCATCGATACTCCCAGGAAGACAGATGATTGTACTACTAAGTACATGAAGGAGATGACTCTCGGGTTGTCGTACCCGATAGCG
AAGACTTGaagcacaagttggtgtataGAGTACACGATTCGCTTATCTtaggtcatctcggtcgagAAAAGACTAATACAGCGCTTGCACACCACGTTTG
GTGGCTTAAATTGAACGCTTGGGCTAAGAAGTACCTTTGCATGTGTGACGCATGTCAGCGTGTGAAGCCCTGCCTACACAGTTAGGAGACACTGCAGAGT
CACAGTATCAGCAGATCGCTGGCAGTTCGTCAGTTGGACTTTTCCGTTGGTTTACCCCCTAACGCCACTGGTActggtctttgtagacccTTGAAGAAAA
TGGTGTACCTCGCACCAACGGTTGATTTTGTTACTGCGTAATAGAGCTCTCGTTTACTtatcgatcgtgtctttcggcaTTACCAGAGTCAATCGTATCC
GATCGTGATGCCCGCTTATAGCGGACTTTTGGGCGAGCTTATTTTAGTCAATTAGAGCTTACCTAAATATGTCTCAAGGACTATCCAGAGACCGATCGTA
AAACTGAATGCGCGAATCGCGTTGTAATATACATTCTGCGCAGTCGTAATGCATCGTCACCGACGACATGGAGAGTTCTGCTCCCAATGGTCGAGCTTGC
CATCAACAATGCGGTCCATGCTCAACTGGGTTTACCTCATTTTACATTTTGTCATCCGATATTTCCTCTTTGTTTCACAGGGGACACGCAAGAATCTGGT
TAGGGAGGGGCTCGGCAAGCGTATGCCTCTCAACTTACTAAGATTGACATGAGTGATATTCGTCAAAGTGTTGACAAGTTCATAACCGAAGGTGCGATAC
TCAGGCGGAAGCGCAAGATTTACAAAAATTGAATCATGGACGTGGAAACCCACATATATTCAAAGGGG