Description :
From Genome Similarity Track
Location :
Scaffold_350:9507- 13101
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_350-snap-gene-0.13Dicarboxylate/amino acid:cation
Pytar_ATCC12531maker-par_contig_350-fgenesh-gene-0.1Dicarboxylate/amino acid:cation

Sequence
3594 bases(100 bases per row)
TCAAAGGCCTCGTCGACGTGCTCGGCAATGATGCGCGCGACGTACGTGTCACCGACAACGTTGCAGGCGGTATTAACGCGGTCGAGGTACCAGTAGATTG
CGACGAGGAACGAGTAGGACGCCGGCATGTCAAAGTTCGGGAAGATCGTGGACCAGATTGAGTAGATCATGATGAGCCCGCCGTTCGGGATGGGGGCGAC
GCCCAGTGAGCTCAGCAGCGACACGAGCACGATCAGCGAGAGCTGCACCCAGCCGAGCTCGATATCCGCGGACGCCGTGGTCGCGAGAAAGACCATGGCA
TTGGGGAACAGCATGGCCGTGCCGTTCATGTGCACGCTCGAGCCAATGGTCACGACAAAGCGCAGCAGGCTCTTCGAGACTTCACGCGTCGACTCAACGC
AGCGCAGCGTCACAGGCAGAGACGCAATCGATGACGCGCTACCGAAGCCAAAGTACACACAGGGCAGCATCTGCCGCATGTATTTGTACGGATTGCGGCG
CGTCGCCATCCAGAGCACGACCGGGTAGAAGGCAAGTTCGAAAATCATGACCGAAATGAAGTTGCTCAGCACGAGCACACCGACGTTCCTCATGGCCGCC
GATAGCGAATCCTGGCTCGAGAGCGAGCCGGNNNNNNNNNNCGCGAGCTCGAAAACTATGACCGATATAAAGTTGCTGAGGACAAGCACACCGACGTGCC
TCATGGCCGCCGAGAGCGAGTCCTGGCTCGAGAGCGAGCCGGCGATCAGCGACAGCACGGCGACTGGGCTCCAGTCGATGAGCTTGGAGATGACAAAGAA
GAAGATCTTGTTGATCTGGTTGAGCAGCTCCAGCAGCGGACTGCTTTGCTGCGAGCTCGCTCGCATGGCCGCCGCGCCAAATGCNNNNNNNNNNTAGCTC
CAGCAGCGGACTACTCTGCTGCGGGCTCGCCTGCATGGCTGCGGCGCCAAATGCAATGGAAAACATGATGACGCTCAGCAGCACGCCGTCTTCAAAGGTC
TTGAAGATGTTTCTCGGGAAGACCGACTGGATGATTTGCGTGAACTGCTGCGCGATACTGACGTGCGTGACGGGCCCGGACGCGATGATGGCATGCGAGA
GATCGATCAACTCGAACCGCGTGAGTTCGCTCATGGTCGTGGCCGTGCAGTCCATCGACCCATTGCCGGCGATCAAGTACCTTCCAGGCGCGCACTGAAC
GTGCATGAAGCCCTGCACTTTGGGTGGCGGGTCAAAATGCGTATGTGGGTTGAGCGGGCGCAGAGACATGGACACGGCGAGCGAGAGCGTCGACGCGATG
CCCGAAAAGAGCAGAAAGAAGAACGCCGTGCGTGTGCCGACCGCCGAGACCTTGCCCAGTAGCACAATGCTCGCGACGCCAGTGGAGAGACTGCAAAACA
CCATGGGGATCACAAAGCACTTGAGCAGCCGCAGGAAGATCTTGCCCGGCAAGTTGACGAGGTCGCTCACGGCGGTCGAGACGCTGATGTGGGAGAGCCA
GATACCGAGCGCCGTGCCAAGCACAACCGCAATGCCGATCTGCGGGTTGGTTTGGCGCAGGAACGACCACCGCGAGTCGCTACCGTCGCCTGGGTACATG
TTGCCTTCCTCGTGGCGCCACGCCTGCATGGTCGTCGTGTTGCCGCCTTTTTCAAAGCCGCTCTTGCGCGCATAGGTTGGCTGCTGGTAGTAGATTGCCG
GCGACGCGATCGAATCTAGCGGCGTGATCGGATCGTCGGAACTGAAGAGCCGGCGCTGGTCGGTCTCGTCAAGCAGCACCACGCCGGGCTTGTCTCCCCC
ATACGGCATGTTGATCGCTTTGCTCTCGGAATGCAACGTTAAGTTGTGAGACCGTGGAACTGTCCGTCTGAGGAAGGACGAGAACACGGGAATGAGAGGC
ACCCAAGTGAGGCTCAAAGCGCAGAGAGCAGACGGCAGGGCGCAACTGCAGCACGCAAGACCAGATCAGACCAGACACCCTGGAGGTTTCAGCTCGCCAC
GGACATGTGGTAGTGGAGCTATTCATACACAGCCAAGAGCTCTCTGTGACGTGTGAGATGACCCATTTGCCTCTCCCGTTCTTCGCTATCTTTGGGGAGC
CAGCGAAAGCCCGTCCTGGGGCTTTCAGGACGGACCAGAGGCGAGTTGCAGGGCTGAGTCCCACCGGTACTCAGCTCTGTCGATTTGTCTCGCTTTGATT
ACGCCGAGCTGTTCCACTCGAAGGTGAAGCCATTCGCGGTGCGTCCACGTCATTGGCTCCTCTGATGGTGTGACTGGTGTGAATCCAACAAAAGTTGTAA
AACAGGGTATACTCAAACCAGTATAAAGTACCGAATCTGTTTAAAACACGGATGATGGCTTTCCAACATGTTCTCACGGCCGTCACCTCATCCAAAGTGT
CCCTCCACGCCCACCGCCCACTTCGCGATCCTCGGGCTCGTCGGTCCCCCCGCCCCCTCACTCCGTCTCCGTCCTCCTCCTTCTCACCTCCTCCTCCCCT
CCTCCTCCTCTCTCCACCCGAGCATGCCGTGCTACCTGACGTCGTGCGATCCGGCGGAGGAGGCCAAGCGCTTCGGCGCCGCGCTCGTCGGCATCTACGC
GTACCACTTTGTATGGGACAAGCTGCTCATCACGCCGCTCGTGAATTGGTTCGTGCGGCGCCAAATGATCACCAAGGACAAGCGCGACAAGATGCGCGAG
TCTCTCTGGAAGAACGCGTCGGTCGGGTCGTTCACGGCGCTGGGACTCTACATTGCGGCCGACAAGGACTGGTGGATGAACCCGCACGGGTACTTTAAGG
AGTGGCCGTCGCCCACGCCCGAGCCCATCCGCTGGCACTATATGATCTACATTGCGTTCTGGCTCCAGTCGGTCGACTTTATGCTCAACTTGACCAACAA
GCACTACATTGTCAAGCGCAAGGACAATGCCGAGATGCTGCTCCACCACTTTGCGACCATCACGCTCATGGTCTTCTCGTACGTTTTCGACATTACGCGA
GTCGGGCTCTGCGTGCTCATGATCCACGAGGTCAACGATCTGCTGCTCGAGACTGGTACGTGCCCATGCCATGTGAGACTTTCGTGTAGATTTGATGTGC
TGAGATATCTCGTGGATGATCCCCTGCCCAACAGCCAAGGTCTTTGTGTACCTCGAGTGGGAGTTGCTGGCCAACATTTTCTTTGGCACGTTTGCACTCG
TGTGGTTTCTCGTGCGCTGGGCCGTCTTCGGGTACAACATTCTCTGGTCGGTCTACACGATCGCCTTTGACGACATCATCGTGCCGATCCAGCAGAAGGG
ATCGTACATGGGCATGCCGGCGAATACGTGGTGGTGGTTCTGGTGCATCTTCCTCGTGTTCCTCGGCATCCTCTTCCTGCTCCACATCTTCTGGGGCGTG
CTCATCGTCAAGATGGTCGCCAAGACGCTCCAGGACGGCAATGTCGAGAAGGACATTCGCAGCGATTCCGAGGACGACGGCAAGGACAACGAGAAGAAAG
TGGTCGAGCCCTCCAAGCCCACACCGGCAGCGACGGCGACGACCAATGGCGACGCCAAGCCCAAGCCGCGCCGCCGTACCCCCAAGGCCGAGTA