Description :
From Genome Similarity Track
Location :
scaffold_349:9507- 11151
Transcript NameFunction/comments
Pl_105785hypothetical protein PHYSODRAFT_538667

Sequence
1644 bases(100 bases per row)
ATCGTTCACTCGGCACTGAGGATAATTGTCTTCTAGCCACCGAACTACCTTGATATGCCCACCGATTAAGGCATCCCGCGCAGATCGCTTTGTACACTTT
CCAATGCAGTGTTCATGCAAGTATAGGAGAACATCCAAGTGTCCAAACCATGCCGCGCCATCCATCGCTTCAGTTGAGCAGCCCTCGGACCGATGCTCAT
GTAACCACTTCACTACATCTAAATGTCCACAGCGTGCAGCAGCGTCCATTGCGTTTTGAGTACAACCTTCACTACGATTAAAGTGAAGGAATTGAATAAC
ATCCAAGTGACCAAGCAAGCAGCAGCGTTCATTGCTTCAGTAGAGCAACCTTCGGTCCGATTCTCGTGAAGGAATCGCACAACAGAGAGGTATCCACCAC
TTGCTGCTCGATCGATCGCTCTCTCTGTGCATCCTTCGCTTCGGTTCTCATGTAAGAACTTGACAATATTTAGATGACCGCCTCCTGCTGCCGAGTTCAT
TGCCCAGGCACTGCAGCCTTCAGTGCGATGTGTATGAAGAAACTTCACGATGTCAAGATGACCTTCGGCAGCAGCGTAGCCCATTGCCAAGTATGAACAT
CCCTCATGACGTCGCTCATACAAAAATTTGACAACTTTTAGGTGACCACCTCGAGCTGCGCCGTCCATAGCGTTATCTGTGCATCCTTCGGTACGATGTC
TGTGAAGGAACTTGACAATCTCCAAGTGTCCTCCTCGTGCTGCTCCATTCATTGCATCCGTGGTGCATCCGCCTGTCGTATTAGCATGCAACCACTTCAC
TACCTCAAGATGGCCGTATTCGGCTGCATGATCCATGATCAAAGGTGACGTATCCTCTGCATCAGGAGATAACAACTCGGTCTTGTGTTCATGCAACCAC
TTCAGCAGCTCTAGATCCCCACGCTTAGCTGCAAACATCATCGCATGAGCGGAGCATCCTTCGCTCCGATTTTCATGCAACCAGTGCACCATATTCACGT
TGCCGTACCACACAGCGAAATTCATTGCGTACTTCGTGCATCCTTCATCACGATGGGCTGCCAACCACTGCACAACTTGGACATGTCCTCGAGCCCCTGC
TTCATCCATTGCATGACGAGTGCAGCCTTCTCTCCGATTTTCATGTAACCATTGCACAACTTCAAGATGTCCATGGGCTGAGGCCAAGTCCATGGCTTTT
GTGCTTGCCTGCAAGTCCGGGATCGTCTTGTCCAGCCACTTGACAACTTCTAATTGACCATGTTCAGCCGCGTGATCCAGTACTGCTCCGTAACCATCGA
ATTCGGGGTCGTATGCTGCCATCCATTGCAACATTGAAATGTCACCACGTTGTGCTGCAGACAAGAAGCAAACTCGGTTGGAAAGCGGCCGCAGACGTCG
CGAGGTGGCACCGAGACGTTGTAGCAGATGCAGATAACCATAGTCCAGAGCTTGTGGGATATTCCAGAGATCGGAGCTGTCCAAATATACCGAGATTAAT
GCTGCCACATGCGGGAGAAAACCCAACGCCTCCTGCTGCTCACGCCACACTACGTTGACGGACGTGAGTAGAGGCGTCTTAGTGGAGACCATGAGAAACT
GATTTGCGACTTTGAAACAGGTCCAAAAACGCGACGAAAAGGTG