Description :
From Genome Similarity Track
Location :
Scaffold_45:95060- 96158
Transcript NameFunction/comments
Phyra_80019protein kinase

Sequence
1098 bases(100 bases per row)
AGACAGCGAGCGACTTGATGGATGAACACAATGTGCGTCAGCTGTCAGTTGTGTCCATATGCAATTACGACAAAATCCGCATCGCGTTCAAACGTTCACG
TAGCAGCTGAAGACATTTTGCTGAATTTTCCATAAATATATTCACGAAGTTTGGCAAGACTCCAACGTAAGCCAATCCTACAGCCGAGAGTGCATTTGAG
GGAATGCTTCAAGCAAGTCTTCCAGAGATAGCCGATCTGTTGGATGCGCGGCGAGTGTGCCTTCCACCAGTCGAGTGTACTTCTTGTCCATATTCTCTCC
TTTCAGTTCTTCCACGAGCTCTTCCACTATTAATGACATGAAGTCAGTTCTGCAACTCACCACAACTCAATGAAAACGCAGACTCGTACCTGGACGAGTT
GCTACTCGCGGCTCTGGATTGCCTGTCAGCATAGCAACAGCTAGAGCACCGAGGGACCAAATATCTGCCTTGGCGTCATAGCTAACGACTTCGCCCAGGA
AGTACCGCCGTACCTCTGGGGCCATGAACGCTAGTGTTCCAGCTGCATGGTGCGTGAGCAGGTCGCTCTCCAGATATGTCGACACACCGAAATCTGCAAT
CTTTGTTGTACCGTCACTCTGAAGTCGTAACCACAAGCCGGTGGCTCGTTAGAGAGTTCAACTGATTGGGCCGCAGACTGAAAGTGAAACTTACCGTCAA
AAGAACATTTCCTGGCTTTAAGTCCCGGTGAACAATTCCGTGTCGGTGAATTTCCTTCAAACCTAGGCATAACTGGTGGAACATCGAGTCGAAGCCATCT
CCTTCCAGTCGGCCCTAATAAAATACTTGTCAGTACAGAAGTATCCTCTCCTTCCTATAAGATCACAACCCACCTTGGTTTCGAGCATTCGTCGCAGATC
GCCACCGTCACAGTACTCCATTTCAATGTATGCGAAGTGTCGATGTCCAATCTCCTCAATGAAGTACTGCTGAATCTGGACCACATGCGGGCTGTGCACC
CGACTTAAAATGCTGATCTCGTTTGCAGCCTCCGGCAACTTATCACTTTCCTTGAGCACAGTGAGTTGTTCCTTGCGATTCTCCACAAGCATCACCTC