Description :
From Genome Similarity Track
Location :
Scaffold_45:95057- 96173
Transcript NameFunction/comments
Phyra_80019protein kinase

Sequence
1116 bases(100 bases per row)
CGGAGACAGCGAGCGACTTGATGGATGAACACAATGTGCGTCAGCTGTCAGTTGTGTCCATATGCAATTACGACAAAATCCGCATCGCGTTCAAACGTTC
ACGTAGCAGCTGAAGACATTTTGCTGAATTTTCCATAAATATATTCACGAAGTTTGGCAAGACTCCAACGTAAGCCAATCCTACAGCCGAGAGTGCATTT
GAGGGAATGCTTCAAGCAAGTCTTCCAGAGATAGCCGATCTGTTGGATGCGCGGCGAGTGTGCCTTCCACCAGTCGAGTGTACTTCTTGTCCATATTCTC
TCCTTTCAGTTCTTCCACGAGCTCTTCCACTATTAATGACATGAAGTCAGTTCTGCAACTCACCACAACTCAATGAAAACGCAGACTCGTACCTGGACGA
GTTGCTACTCGCGGCTCTGGATTGCCTGTCAGCATAGCAACAGCTAGAGCACCGAGGGACCAAATATCTGCCTTGGCGTCATAGCTAACGACTTCGCCCA
GGAAGTACCGCCGTACCTCTGGGGCCATGAACGCTAGTGTTCCAGCTGCATGGTGCGTGAGCAGGTCGCTCTCCAGATATGTCGACACACCGAAATCTGC
AATCTTTGTTGTACCGTCACTCTGAAGTCGTAACCACAAGCCGGTGGCTCGTTAGAGAGTTCAACTGATTGGGCCGCAGACTGAAAGTGAAACTTACCGT
CAAAAGAACATTTCCTGGCTTTAAGTCCCGGTGAACAATTCCGTGTCGGTGAATTTCCTTCAAACCTAGGCATAACTGGTGGAACATCGAGTCGAAGCCA
TCTCCTTCCAGTCGGCCCTAATAAAATACTTGTCAGTACAGAAGTATCCTCTCCTTCCTATAAGATCACAACCCACCTTGGTTTCGAGCATTCGTCGCAG
ATCGCCACCGTCACAGTACTCCATTTCAATGTATGCGAAGTGTCGATGTCCAATCTCCTCAATGAAGTACTGCTGAATCTGGACCACATGCGGGCTGTGC
ACCCGACTTAAAATGCTGATCTCGTTTGCAGCCTCCGGCAACTTATCACTTTCCTTGAGCACAGTGAGTTGTTCCTTGCGATTCTCCACAAGCATCACCT
CAGCGAAATTTCCGAC