Description :
From Genome Similarity Track
Location :
Scaffold_374:9505- 12477
Transcript NameFunction/comments
Phyke_g9678hypothetical protein PHYSODRAFT_475526
Phyke_g9679Avr4-associated TDF-like protein

Sequence
2972 bases(100 bases per row)
AATCCTTCAAACGCACGTGGGAATTTTATCTGCTACATTCCGCTGGTTGTTACAGAGCTGGAGCACTTCAAGCATATCAAATCAGAATGGGTTAGTTTAG
GTACCCAAAATACACCCCCAAGTTACCCATTCAATTTTACCCATTTTCAATCGAATGGGGAGCAACGAGCTGGATGGCGACGCCGGCGGCGCGTGGGAGA
AACACGTGGACGAAGCTTCCGGTTCGACGTATTACTACAACCAACACACAGGTGAGTCGTCCTGGGAGGTGCCTGAGGGTTTTAAACCTCCagtgaagca
ggagaagagCCAGCACAAGCCTCCGAAATGGTGCAAGTTTGTGGACGACGAGTCTGGCGCCACGTATTATTACGACCAAGTGAACGGCATCAGTCGGTGG
GAAGAGCCTGAAGATTTtaaagaggaagaagaagagcaggttacagctgagaaggagctgagtcaggagcaggaagagacggagcaacaggaacaggagc
aggagagTCCTGTGTACCAGAAGGAGACACAGGAGCTGAAGGCAGAGCAGAAGGAAGGGGGGCAGTCTAGTGATGTCAAGACTGCCGGCGGTGAACAGAA
CAAAGGAGCGGAGGAAAATGCTGCTAGTTTGGATGCTACTagtgctggtgctgctcagTGGACGAAGTTTGTGGACGCTTCTAGCGGCAAACCGTACTAC
CATAACACCAGTACAGGGACGACGCAGTGGGAGGAGCCTGAGGAGTTTGACGAGACGGCAGTACCAGAAACCCCCGCTGGCCCGCAGGTGTCTGCTGAGT
ATCAGGCTCATCTTAACCGAAAGCACACGGAACACTTGGCACGTGTGACGCAGCAAGTTTTAGATCCGTCGGGTAGTCTCAGCAAGCTGAATGCTATTCT
GAGTGGCATTGATGGCAGTACTTCTGCTAAAGTGATGGTGGATGAGAAGAGGGATAAAACTGAATTACGGACAGCGAAAGCCGAGTGGCAACAGCATATC
GATGCGCAGACGCAGCGATACTACTACCATAATGTGGTCTCAGGAGTCACGCAGTGGAATAAGCCAGATGCACCTATTGTCTCGGGGGTAAGCTTGCGTG
TGTTATATGCCTTTGCAAGTATGCTGAATTGAGGTACTAATATCGGCTGTGTCGTGATCATGAGTAGTTGGCGGATTGGATCCCTCCGGAGGTCCCAGAG
TCCGGTGAAAATGGTGCGGGAAGGAAGGTCGTATCCGGCGTGAATTACGTAGCGCAAGCTAAGTTCAACCGGCTCACGGGTAAGTACGAGCAacttggtg
gtgatgactaTTGGCGAAATGCGGGAGTCGCTTCCGATCGTGCAGGCCGGCAAATGAGCCACTACTTTGACATGAGTGAATTCGAGAAGAACCGTGAGGA
GGCAAGGCGTAAGAAGGAGCAGCTAAAACGCAAAAACATCGACTGGAAAAAGATAGCGGCGgagaagaaagcgaagaagcagaagcagaagaatgAGTGG
CTCTATAATGACTAACTTAAAGAGTGACTTTTACGGGTGGAATTTTAGCTGTTGCAAAATTGGACCGCTGAATCTCTACGTTCGTGAtatgctgctggtg
ctagaGTCTTTCATAATACCCTGACAAGTTATCACTGCACCAGAATCATGGCCAGAAAcactgcagaagaagaaaaaatggCACCAGCTTTACGATGTGT
TTATAGCTAAGCGGCCGAAATACAAGTGTAAAATACGTCAAAGTGCGACGTTCAATGCCTCTACAAACCAGGGTACAAACCGAGGAACCCAGGAGTTGGC
TCGCCCTGCACCTCGCCGAAGTACAACGCGAACGTCTGACGCCACTGCTCCACAGACTCACGGTCCGCCATGAATTTCGGGAACTCGTCCACGTTTGCCT
TGCAGATCTCCCACGGGTGACTCGAACCGCCATTCGCAGCTAGGTCCACACGCACGTTCTCGGCCACAACCGTCTTCTGCACCTCCTCCGAAATGGCCCA
GTTCATGAAAAGCTTGGCGGCCGCGGGGTGCTTGGCCTTGTTCAGGATGGCGATGCGCTGACCCCATGCCAGATATTCGTTACCGTTATCCGTCACGAAG
GTCACGTTGGGTGCTCCCGTCGTGTACGTTCCAACACCGACGACCTTGTCCTTGGCCACAACCAAGTCATTGGCCGTGTTGGAGCCGCGGCGGAACGTTA
CGTTCTGGTTGGCGAAGTCCTCGACCCAGTTCCAGCCGTATTTCTCCACGTAGAGCTTGTACACGAAGAGTACAGCGTCGTCGTCCGTCGGGTGTGTCGA
CGCGATCTTGCCGGTCCATTGCGGCTCCACGAGGTTGGCAGGGGACACGGGCGCTGCGACACCACCCAGCACGCTCGAGTCGTACAGGAAGCTAAAGGTG
AACATCATGTAGGCCATGTAGGCACCACGTTGGTCACGGAAGCCGTCATAGACCTGTGAGAAGTTGGCCGGCTTGTACTCAAGCAACTTTCCCTCCTGGG
CCCAGCGAGGGAAGTCCTGTAGCGtctgcagcgccacgagGTCGGGCATGAGTGTGTCGGTCTCAAGCTGGTTGTCGATGCGTACGTTGTGGTACTTGCT
GTAGTCCACGATGAGTGTGAAATTAATTTCTGGGAAGGCGGCCGTGAAGGCCTCGTGAAGCGATTCTTGCTGCATTGAGAAATCTCCACCATGATACATG
ACGAGTTTACCGCCCTCGGTGATGGCGTCGGCATAGAGTTGGTCGATAGACTTGGTCTCTTCCTCGACCGCGAACGCGTAAGTGGCGAGGAGCGCGCAGC
ATGCGGTGGTGAATGTCGCGAAGAATTTCATGAAGGTCGGTTGGTGAGTAATAGTGGTGAAAGCGTGCTTGGATGGACACTTGTGGTTGGTCGCTGGTAA
ATCAGAGAATGAAGAAGTGCTCGTCCTCGCAGATTGCAACTCGGAAAACTACGATCGGGAGTGAGAACTCGA