Description :
From Genome Similarity Track
Location :
Scaffold_126:95023- 99529
Transcript NameFunction/comments
Physo_142980kinesin heavy chain
Physo_142981hypothetical protein
Physo_142982AT-MCB1 (MULTIUBIQUITIN CHAIN BINDING PROTEIN 1)
Physo_142983hypothetical protein

Sequence
4506 bases(100 bases per row)
AGTATTTGGTGGTGCTGCTGCTTGCCCTCCTCCGGCACAGTCTCCTCCCTTCTCACCTTGACTTCGATCGTCGCCTGGTCCGTGAAGACGCAGCGCTGGG
CCGCGGCCATCGTGAGCTCCTTGGCGTTCTGCGGGCGCACGCGGCAGCACACGCGCACGTTGCCCATTTCTTGCTGTAGGTGGAAAAAGTTTCCCAACAG
GTTAGCGGCCAATTCCCAGCAGAGATCAAGCGCGGGCAATGCAGATCAAGCGCCTGGGGTTCACTCACGCCGGTGGACGAGGGACGCGCCATTGCTCTCG
GCGCTGTAGGGCGTCGCCCAGCTTCCTCCCCTTCCTTCCTCCGATGCAGCAGCAGGAGCTCAAGTGAGCGAATGAGTTGGCTCGAAATACACACCTTCTT
AGATCGTACTTAGTCCGACCAAATGGCTACAAAGCAAAATAGAGACAACACCGAGTTTAGATTTTGGACACATGGAGGACGTTTTTACGAGCGCGAGAGA
CTTAGGAGGACGGGGAAGTGCACGTCGGGCACGTAGTCGGCGCGGGTTTGCTGGTAGGCGGCGTGCTGGCGGACGATCTCCGGGTCGTAGTCCTCCGACT
TGTGGACGGCGAAGCCGTGGCGCGCGGCGATGGCGCAGAAGCGCTCCATGGAGCCGTTGCGGCTCGGCTGCAGCAGCAGACAGCGCCCCGAGCCAGGACG
CAGCAGACTCTTGACGGTGTGGGCCAGGTCCTCGTGGAACTCCTCGAAGAACAGGCAGTCGCTGGCGAACACGAGGTCGAACTGCTGCTGCAGGTCCTCG
CGCAGCTTGGCGTCCCGGTCCCAGCGCAGCAGCTCCGCCGTGATGTCTGTGTCTTGGCTGCGGGCAGCGAAGACCTGCTGCTTCCTGTTCTCTTCGACGC
AGAGCTGCAGGTTCTTCACCGACAGCGGGTTGCCGTCCGTCACCACGACACGACGTAGATCCACGGGAGGACGCGCCAGCAGCCCCAAGCTGGCGAGTCC
GGCCATGCCGCTGCCCAGCTCGCAGCAAGCAACAGGCAGTGGTTTGCCACTAGCGTCTCGCCGTTGAACTTGAGAGCACACGCCGCTCTTGAGCATGTAG
GACAGCAGGATCTGCTCGGACGGCCACGTGCGGATGTTGCCCGTGTTGTCCACGCCGCGGTTCACCTGGTGGCTCAGCAGCTCCGCGATGGACACGCGCT
TCACGTCCTTGCACTTCTCGTGCACGTAGATCTTCGAGCCTTCTGCGCCGGCTGCTGGGGGCAGATCGTAGGCCACCCAGACGAAGTTTTCCTGCGCGGG
CGAGTGGATCCGCACTCGCGTCGCGTCCACTGCGCACTCGGCGAAGAGCGGGAAGAACTCGGTGGAGATGGAGGACGCCGTCGCGCCATTCACCGCGCCG
CTGGACGTTGAGCGCAGCAAGGCCTCGCGCAGCACGCGCCAGTGTCGCTGCGTCTTCTTGTCCGCCACCATGCTTGTCAAGCGTACCGCAACGCCAAAAG
AATTGTTTTGGCCAATCGGGGCGCAATCGTGCGTGGATTGGTCAAAAACATATCCATACCCGATCTTCTCTTGAGCAGAGCGCAAAAGCCCCCAGCAAGG
TCAAGATGCCGCTCGAATCGACGATGATATGGTGCGTGTGCGCGGCTTTGATGGCGCTATTAGCGACTGCATCACGCCCCCCTGCCCATCGGCTTGCTCT
GCGTGCAACGCGCACCGCGAGCCGCCCATTATTGACGCCTCTGTGCCTCTTCCTGCGCGCAGCTTGGACAACTCGGAGTGGATGCGCAACGGCGACTACA
TTCCCTCGCGTCTGGAGGCGCAGCACGACGCCGCCAACCTGCTGTGCGGCACCAAGACGCAGGCCAACCCGGAGAGCACCGTGGGCGTGCTGGCCATGGC
CGGCAAGAGGTAAGCAAGGGCAGACTCGGCAGATCCGGTGTCAATAATGGGCGACTGACTTTTCCACACGCTGCGCAGCGTGCAGGTGCTGGCGTCTCCG
ACCGACAACATGGGCACGCTGCTGAGCGCCATCCACCGCGTCAAGATCGGCGGCACCATGAGGCTGGCCAACGCCATCCAGGTGGCGCAGCTGGCGCTCA
AGCACCGGCGCAACAAGACAGGTGAGAGGGGACGAGTGGACGTTTGCTTCAAGGTGGAGACGATATTTTGACAAGTGTGGGGATGCGGCATTTTTGACAG
GTGGCCAGCGCGTCGTGGTATTTATCGGCTCGCCCATTGAGGAGGACGAGAAGCAGCTGACCAAGATCGGCAAGCTGCTCAAGAAGAACAACGTGCGATC
TGCACTGTTGGCTGCGGTATCTTTGGTTGCAAAGGGGCTGACAGGATGTTGCTGGTGTTTTTGACAGATCGCGGTGGACGTGGTGAGCATGGGGGAGCTG
GATGCCAACGCCGCCAAGCTGCAGGCGTTCGTGGACGCTGCTAGCAGCAACAGCAATAGCCACCTGGTGACCGTGCCCGCGGGTGTGCTGCCCTCGGACG
TGCTGGTGTCGTCACCTGTCCTTCACGGAGACGACGGTGCGGCTGCGGCCGCTGCTGCTAGCGGTGGTGGTGGTGGCAACGATGCTTTCGCCGAGTACGG
CGGCGTGGACCCGAGCATGGACCCCGAGCTGGCCCTGGTACGGACCGTGTTGCGGTGCTACTATGCAGAGAGAGGGGAATACTGATGTGCGTCTGCTGCT
ATACAGGCTCTCCGAGTGTCGATGGAAGAGGAGCGTGCGCGTCAAGAAGCTGCCCAGAAGCGCGCGGCCGAAACGGAGGCCGCCGCTGCCGCTGCTGCTG
CTCCGGCTCCTGAAACCCCGGCTGCTGCACCAGCTACCGAAGCGGCGGCACCGCAGGCGGAGCCCAAGCAACCCACACAGACACCAGCGCCCGCGACCGC
AGTGGCTGCTGCCCCGGCCGCCACGTCGTCGCCCCCTCCGGCGCCAGCCCCGGCCTCCAACTTGCCGTTCATGGACCCCAAGTTCGTCAACTCGCTGCTC
TCGGGCCTGCCTGGTGTAGACCCGAACGACCCCAAGATCCAGGCTGCCATGGCGCAGATGGCCAAGAAGGACGACAAGAAGGACGGCGACGAGGAGAAGA
AGGAGGACAAGTAGAAGGCGATCGAAAGATCCGGCGCGCTGGCGTTCGTTCCGCTGGCGCACCGGAAGTCAATCTACCACCATTTTAGTCCTCCCCAAGA
TGTGACGTGGACGATTCTCCATCTTTTTGACTAACCAGCGTGATCACTTTGGATGCTTTTAGCTCTCTTCCCTCGTGTCCTGGTCGCGGCTCACGGCAAA
TGGTTGGTGCGTGGATATCTGAGAAACGCTTGGTAGCGTTGAAGTTGCCCTTCTACGCGCGTTCCAAGCTGCCTCAATGGGCACGACGTCGTTATGCTTA
TTAACCGTTTTCTGCTTTCTATAGCGTTGTGTACACTCTTCTTCTCCTTCTCCTCGTCCCACGTCGGCAATAGCGCAACATCCACACGCGCTTCGTATTT
ATAAGTGGTGGCCAGCAATCCAGCGAGTCGTTGGTCTTCGCTAGACAAGACCCACGTCTAACTCTGTCACTTGGCAATAGTTTCCTGACCCCATCGATCG
GTCGAGCCATCGGATTCTCCATCTTCCTCCCAAGACTTCATCGAATCTGCCCATTGCATTTGCTCCCAGGTCGTTGCGAGAAGCTCCTCCCCTTTGCGGG
TTAAGTCAAGTCGCCATGGTGCTGCTGTTCCAGCGCAAGGACTCGGTGCTGAGCGAGGAGTCGAAGCGGTTTCTCAACTCGCTGCCCTCGACGTTCATCA
ACCTGTTCCGCAAGCGGCGTCAGCTGCTGCCCGTGTGGAGCTCGCACAAGTACTGCGCCATGATCAAGTCCACGTACCTCGTCTACTACCGAGCCACCAA
GCCGGAAGACGCCGGGGTGCCCGGATTCTGGCAGCAGCACACGCTCAAGTACCTGAACCTGCAGAACTGCAAGATCAAGCTTATCGACGACGACTCGGCC
GGCTACGTGTTCTGCATCACGCCCGAGTCCGGCAAGGGCGCGATATACTTCGCCGCCGACACGGACAAGGACCGCGCCAAGTTCGCAGCTCAGGCCGCTG
CAGTACAGCACCGACTGCCGTCTCTGAGCGAGTTCACGACGCTCAAGCTGCTCGGTCGCGGCCACTACGGACGCGTGATCTTGGCGTCGTACGCCGCTGA
CCAGCAGCTGTACGCCATCAAGGAGATGAAGCTGGGCCAGGTGAAGGCGAAGGTGGTGTTCGCTGAGCGCTCGGTCATGGAGTGGGTGGGCGACCACCCG
TTCGTGATGGGGCTGGACTACGCACTGGCCCGGGGTCGCTCGGTGTTCCTCATCTCCAAGTTCATGCAGGGAGGCGACCTCTTCCTGCACATGCAGAACA
GCGGCGGCAGCTTCAAGGAGGACGCCGTGCGCTTCTACGCCGCTGAGCTGCTGCTGGCGCTCGAGCACATGCACAACATGTGCATCCTGCACCGCGACAT
CAAGCC