Description :
From Genome Similarity Track
Location :
Scaffold_27:950- 2625
Transcript NameFunction/comments
Aphin_H310_14844unnamed protein product

Sequence
1675 bases(100 bases per row)
CACTCGGTTCACAGCATTCACGTACGCAGTAGCAGACGCGACCAAGATGTCGGTGTTCGCACCGTGGCCAACATACTGCCGTCGTCGGCTCATGCCAGTC
TGAGGGTTCAACCCATCGGCGGCTTGGTTTGTATCAAACTCACTCACACGAACCGTGACTTCGCCGAGGGCGCCCGTGCCGTCCGTGATGCTTTCGACCG
TGTACTCGTTGAGCTTGAGTTCGCCGCACCTGGTTGCACGGGCAATGGCGGAAAACATGGCGTCGATGGGGCCGCTGCCCATGGCCGCCTCCGACACCTC
CGACCCGTCCTTGAAGGTAACTGTGACGGTTGCTGTGGGTTTGACGAGGTTGCCGGCAGTCACGTGGACCGCGTCCAGCGTCCAGTAGATCTCGGGCTTG
AACAAATCGTCGTTCACGATCGCTTCCATGTCGGCGTCAGTGACACACTTCTTTTCATCCGCCAACACTTTGAACTTTTCAACGAAATGGTCGAGCTGTT
CCGTCGTCAAGTCTGCATATCCGAGCTCGGCCAGGCGCTTGCTGTACGCGTGGCGCCCCGAGTGCTTGCCGAGCACCATGCGATTCTCCGTGAGACCGAC
AGATTCGGGCAGCATGATCTCGTACGTGGCTTGGTGTTTGAGCACGCCGTCCTGATGGATGCCGCTCTCGTGCGCGAACGCGTTGGCGCCCACAATCGCC
TTGTTCGGCTGGATCGCAATGCCAGTGTAGTGGCTGACCATCCGGCTGCATTTCATGATGTGCGTCGATTCGATGTGCGACGCCACGGGGTACAAGTGCG
GACGAGTCTTCAAAGTCATCACGAGCTCCTCAAGCGACGTATTCCCGGCGCGTTCGCCGATACCATTCATCGTGACTTCGGCCTGGCGCGCGCCGTTCAG
CACACCCGCCAGCGTGTTGGCCGTCGCGAGCCCCAAGTCATTGTGGCAATGCGTTGAAAACACGGCCTTGTCCGCGCCACGTGTGTTCTTGATCAAGTAA
CCAATCAACGCACCGTACTCGTCAGGCACGGTGTATCCGACGGTGTCGGGGATGTTGAGCGTTGTCGCGCCAGCCGCAATCACTTCGGCAAGCACATCGC
AGAGGAAGTCCGGATCGCTCCGTCCAGCGTCTTCGGGCGAAAACTCCACTTGTGGACTCAACGACGCGGCAAATTGCACTGCCTCGACGGCACGACGAAT
GCATTCGTCTCGTGAGATCTTGAGCTTGTACTTGAGGTGGATGTCGGACGTGGCAAGGAACAGATGAATGCGGTGGTTCGGTGCGTGCTTGACAGCGTCG
TAGCACCGCTGAATGTCCTTCGCCGTCGCGCGTGCCAACCCACAAATCGTCATAAAGTCTGGGTTCGAAGGACGAGACAGCGGCCCGATTTCTTGGGCGA
TCGCGGACACCGCGTCAAAGTCACCTGGAGACGCGATCGGGAACCCCGCTTCGCACACGTCAACGCCCATCCCGTGGAGGCCTTTGGCAATGTGCAGTTT
TTCCTTGAAGCTCATCGTGGCGCCAGGGGACTGTTCGCCGTCGCGCAGGGTCGTGTCAAAGATGATCAAACGCTCCTTGTCTTGCGGGATGGCAGTGGTG
GACGAGAAGGTGCGACGGGGTGCCTTGGACGCAGCCACACGGTGGGAAGCTCGTCGGGCGGCGGTCAACATCTTG