Description :
From Genome Similarity Track
Location :
Scaffold_566:95- 2703
Sequence
2608 bases(100 bases per row)
CGAAAGCCTGCACACACTGTGGCTTGAAAAGTCATGATGATCGCATATGTTGGAAACGATTGACCTGTCAAAAGTGTGGCCGCAAAGTACATCCCTCGGA
AAAATGCCTACATGTGTGTCCCGCCTGTGGGGAGGTTCATGAGAGCGGTCAATGCCGCATGGAGGAGTTCTACAACCTTATTCGTATGTGGTACGTGCCG
ACCAAGCACGCGGGGCTAATCAAGACCAAGGCAGAGAAGATGTTAAACTATGACGCTCGCCAGGTTGGAATCTGGCACAAGCCGAGCGTTCTAGGCTATG
CATATATGCATTTGTGGAGACGGAAAGGATCGATCAGGGAGCAACAATCGGATCGGCCCGATCGCTAATACATGTTATTTGGATAACCATCGTTTGCGTA
ATATTTCAAGTGTGAAGAAGGTGGATGAACATTCGCGATCTCCTCTTAAGATGGAGCTCGATCTAGCGCCGAGTGAGTCGAGAGGGTATTGGAAGTATCT
GGAAAGTGGTTTGAACAAGCTAAAGCGGTGGGCAAGAAACAACAACGAAAGAGCCACTATGCTATTCGATTCTGGAGCCGAAGTCTCAATCATCGACGTT
ACCTTTGCTTGTAAGGTGAGGTGTATGATCGACGACAGCCAGAAGCGAGAATGTGTGGGAATCGGGGAGATCGCCTACATGACTGAAGTGTGCACCAAGA
TCAAGATCACACTAAACGGATCACTGGTATATTATTTTGACGTTTGGGGTGGGCGATCAAGTTGGCCAAGAAGCAATCTTAGGTATGGATTTTATGGTGC
CAGCAGGGATACGTCTGGACCTAGCGGATGAAACGCTTTGTTTGCAAGACGAAGTGAAAATTCACCTGGCAGGGCGACGACCTCCATATGGAGTAAATAT
AAACCCCATATCAACATGTGGTAATCCCAGTCGGAGGATCCACAGAAATGAAGATTGGAGCAGGTTTCCCTAAATCCAAACTATGGGTAAGGCGGGACAA
GAAGTGGGTACCGACGGTTACTACTGGCCCCGGACAGATCAAGTATTTGATACTAACCAATATCGTCGATCAGGAGGTAATTCTCAATCACGATACACAT
CTAGGGTGGCGGATGATGATGGACATAATACCTCGATCACCGGGTTATGTTTAGGTCGGATCACGCCGGTATAATGAATCGCCGACTATGGCGTTCGAGG
CCACAACGAAGTTAATCAAAGAACGTCCGATCAAGTATTCGGGGCCTCTATTGGACCACCCGTCGTACACCATCCCAAGAAGATTCTGAGGCATAGGGAG
AAACAAGAAAAAGAAACGGGGGTAAGCCGATCGGGGAAGGTCGTGTCACAACCAGGAGTGTCAGATATTACAAATCACGATAAACGAGTTAATATCGAGA
ATGTAGAACGTCCTTGCAATGAAGAACAGCTATCGTTAGAAATGCCTGCTGCAGTCAGTATGATTGCAAAAGCAGGGAAGGGTGATCCGGCACAGAACCG
GTTAGATGAGGCGATCGAGCAAGCAAAGGCGGTCGCGACTGAGGATGATTTCCGGGATGAGGACGATCAGGATCAAAACTGTCAGATTAAGGGAGTAAAA
GCGCTACAACGCCCACGAACGAAGAAGACTCAGCAGATAACAATCCGACGAAAACTGCGGTATATCGCCATGACACGGTTGACCTATTCGCCGAAAACGT
GGACCAACATATGGCAATCTTGCCAGAAATAGTCGCTCCCACGGTAGAGGTGGCTATCGAAGACATCCAATTCGGCGACCCAGGTAAACCACTGACAGAT
GATCAAGAGAAGTTGCAACAACTGATCTGGAAGAATCGCCATTTACTCATAGGGAAGCGGAATGCCCTGCCTCCAGCTGCGCGTGGAGTGGTATGCGATA
TTGATGTCAGCAGTGCCAAACCGATCGCGCAGAGAGTATGGCCAGTGGAACCCAAATATCCAGAGAAACTGGCAGATCTGATCAAGGGACTCCTATCGGC
CAAGATCATTCAACCATCCACCTCACCTTGGGCTTCCCCTATTGTGGTGATCATCAAGAAAAATGGGGAAGATATACGACTATGCATTGATTACAGAAAG
GTGAACTAGTTGACAAGATTGATAATATATCCCATGCCACTGGTTAGCGAATTACTGCAAGACCTGGATAAAACGATGTGGTATTGCTCTTTGAACATGG
CGAGTGAATTTTGGGTGGTGGAGATGACAGAACGAGCAAAAGCTATTTACGCTTTCGTCACACCTTCGGGTTTGTTTGAATGTTTACGAATGCCTTTTGG
GTTGAAAAACGCTCCCCAGATCTACCAGCAACTGATCGAAATTGCACTATATGGGTATCTGAAGATCGGCCCAAAATCTAACTCGAGTACAACACCTTCA
TCTACGCCAACCGATGTGTTCACTGACGGAGTGCTGGATACTACCCCTAGACCGTCGGTCCTAGGTAGAAGATCGTATACCGACGACATCTTGATACCTG
CTACGTCATGGACTTTCCTATATGAAAGGGTGGAACGGCTGTTGGAAGTGTGTGATAGATGAAACTTATCGATCAGTGTAGCCAAATTTTCTAGGGGCGT
CGCAAGGT