Description :
From Genome Similarity Track
Location :
Scaffold_3053:95- 1740
Transcript NameFunction/comments
Phyag_g13004hypothetical protein PHYSODRAFT_517932

Sequence
1645 bases(100 bases per row)
CTACTAGGCAATGCCTAGTTCTCGTGCTCGGCCGTGTAGTTGTAGTACACGGTGTTCTCGAACTCCGGCGCGCAGAATGGGAAggccgcgtcgtcgtcgc
tcggaGCGAACAGGTTCTTGCCCGACGTATACGTGACGTAGCAGCCCAGGCAGAAGCACACGACGACCACCGTGAGCGCCGGGGCCTTCTCCCACATCGG
AAGCACAccccacttcttcttcaacaggAACACGATGGGCAAGATGATCGAATTCACCGTGATGCACGACGCGCCCGCGAAATCGGCCAAATCGTGGAAG
TGGTCCTTCAGGATAACGGACGCGATCACCAAGCCGGTGATAATAACGAGACGCAGGATGACGTACTTGATGGCGTTCACTCCGCGGTACTCGGCGGCCT
CCGCCTCCGGGTCGCCGAGGTGCACGTTTTCATTATCGGCGACAGAAATGAACGAGCGTCGCTTTGAGGCACGCGACGTGTGCGAGTGTTTTTCGGAGCG
CTCGGTAGCATCGGCCGGCGTGGACACGTCGGCGTAGTTCAGCAGGTTGTTTTCGACGTCGTTGACGGCAGGCTTGTGCATGCCCAGCACGATGCGCTCG
GCGATGTAGAAGGCTGGGTTCAGGATAACGGAGAAGGCGATCGTAATGTGGAGCTGCATGAAGAGGTAGGCGAGGACGACCATACCCCAATCGGACGCGA
AACCGAGCGTGGTCAAACCCGTCTCCGCGTCCGGGTAGATGGCGTACAGGAGGTTGCCCGAGATCTGGCAGCCGATTGACGAGTAGGCTGTGCTGGCCAG
GATAAGGAACAACACCGAGATGAATGACATGGTCACGCCCACCACGCGGGGCATACGCGTGGGGTCGCtgtgttggcgctggagtgcTGGAATCACGATA
CCAGCACCGTACGCGAGCGCCAAGTTGCCAAAAGCACCGGCCACTTGCTTGAAGGTGAGGTCGGGCTTGGGAATGCTTGGGTGGCCGCGCATGCCGTGCA
tcacgacagcgacgccgatGATATCGGTGATGATGGTGCCCATGCAACCGGCAAAAgcggcgccagctccttccttGAGAGTTGGCACCAAGCACACAGG
CAGACAGGTGACCGCCATGAGGATGATCCATGTCGTCGCGCTGAAGGCTCCCGGGAAGAggccgtccagcagcgtgccTCCGAGCACCAGGAACACGCAC
GGCACTAGCAGGCAGTTGGCCATCTGCGAGACGACCGAGAGGTAGCGGCCGGTTTTGCCCATGCACCATTCACCGAGGTCACCGTAGGTCTTGACCGATC
GAGGGGCGAGGAGCATGACGCGGCAAATGGCCACCGCGCCGTAGACGTTGGCGAAGGCCATGAAGGCCATGGCGATGACCGCGATCACAGGGCCGGCGCG
CGAGAAGTTACCGGGCATACCAAGCGTTCCAATGCCgtagacgcagcagaagaggttgaaggccgccttggcgtcctccacggTGAAGAAAGCTTTGCGC
GGCATGGTGGGAGCAGTGAGGGCGCTGTTGGAGCGAGCACAATGTAGTGGTCGACTTGCTGCGGTGCGTGTGGATTGAGCGGAAGGTGGTAAATCCGGAA
GTGAGGAGGTGAAAGCTGCGGCGTGGTGGCGGCTGGGTCGAAGAG