Description :
From Genome Similarity Track
Location :
Scaffold_210:95- 1677
Sequence
1582 bases(100 bases per row)
AACGAATCGCCGAGTTAGGTCGGCGGTTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGTTCGCTTCCAC
CCGGTTCCGACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACG
ACGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCAGCTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTATG
CGGGACTTTCTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTA
TTGACGGCAGGCATAATCCAGCTCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGACTAGAAAAATTCTGCTCTGTTATCTTCTGGGAGCCCT
TTCGGCTCCCCCTATTTAATCCTATGCTTCTCATACAAATATCTAGTGAAATGTAGTCGTTTCGGATCGCTACCGACCCCTTCAGCTGAGTTCGGGCGAC
CGTTGAGCTCAGCGGTTTATCCGGATAGCATATCCGGACAGATCGCCCGAGTACTTTACCGTGATCCTTTGTTCTTAAGTTCTGGGTTATCAGACCGAGC
CCGATTCCTGACCTAAAGTAGGTCGGCGTATGGTCGAATCTGGAAATCTCTACACCACAACTGCCCCGATTATGATACGAGCCGAGCTGGTGAGTGTCTT
AATCCTTCATTTGGTCCTGCCACCGTTGGTCCATACTCGGCTGATGATGTCCCGCGGCTCTCCACCACCTTCTTCGGTACGTTTGTTGCTTCCGCTGTCA
CTCCCTTGGCAGCTCCTTACTCCTCGCTTGTTACTCCAGCACAACTCGCGGCACCATCATTCTTCTCCAACTCCTCGTCGAGGTGAAGGCGTGCCAGCTG
AGTCGATTCCCCGACCCGTCGGTACTCGTGGGGTCAGCGACCGGCCTGAGGCTAAGCTGGTCGACCTGACAACTTCTCATGCGTCTGACGCGGAGTCGGC
GGGGTCTTCTCGCGTACGCCTTCCTGGTCCACCGAGCTTGCCGGGCGACACCACTTCGGGCGCTCTACACATGTCAGCCAAGCTCGGCTGCTCCAAGTGA
GTCTTTGACTCCCTCATGGCCAGAGTTAACGAACAAGGGTATGAGCGCCGAGAAGAATTGACCTTCTTGACGAGGCTCATGGCTTACGGATTTACTCGTT
CCGTGGAGCCCTTCGATCCCGTGCAGCGGCGAGCGATCTTGCATGCTGCTTCCGCGGGAGAACTGTTGGATATCTTGAAAGGCAACTACGCCGCTCTTAA
TTATCCACAGATCATTGGCGATCTCCGAGCTGACAATTAAGCTGTTCAGGAGGAGAACCGCTCACTGACTCGGCGACTGGACTCGCTTGCTCTCAGCAAC
GTCGACTTGTCAACTCAGCTCTCGTCGGCTCAACAGCAAGTGTCTCGATTGGAGGCTGCTGCCACGCAGTCGGCTAATTCCC