Description :
From Genome Similarity Track
Location :
contig_11:949808- 951727
Transcript NameFunction/comments
g2743.t1hypothetical protein F442_21922

Sequence
1919 bases(100 bases per row)
TGCAATACGGACGGGTAACCTGCGCGGTTGACACGCACAGCTTCAAGGACACCGCCTGCCTTGAGCTGGTCGCACACACGCTTGGGCATCAAAAGGTTGG
CTTTTGCTTTGTCGTTGGGCTTGAGGCAGCGTACGTAGTGGCAGTCAGTCACATTGATCGTTTCCAGAAGTGTCTTCAGTTGAGTACGGAACTGCAAGCC
TAAGCTCACACGTGTGGCAACACTGGAGGCTCGGCCCTTCGGCTTCTTGGACGGCACTTTCTTCTCAGATGAAACCTGCAGCAATCCCCGAACGAATGGC
TTCGACGATCGCTTGATGATCGCAGTGATCTCCGGGTACAGAATGTCCTTGTTCTTTTCACAGAATCCAAAAGTGTCGTACGAGACGGCGCCGGCGTAGT
GGTGTACAACAAAGAGGTGGTTGGCAATCTCCGTCTTGGTTGCGCTAAAGTGAGGGTTGAGTTCGTGCTGTCGGTACAGCTTTCGCGCAAAGTTCTGATC
GCTACCCTGGGGAACGATGCACTCTTCGTCAAGTGCCGGGAGGATGCCGAACGGCTTACCCTGAATCAGGTCAATGCACGGGCCATTGTCTGGGAAGTTG
ACGAAGCTCCACTGAATCTCTTCCTTCTCGTACGTCTCCTGTTCCATACGCAAAACAGTGAGGTTGAAGTGCTGCTGTAGCGTTTCGTTAGCGTAGTTGA
TGCACAGTTGCTCGAACGAGTTGTGCTCCAGGTCCTCGAAACCAAAAATATCGAGCAGGCCAATGAACGGGACATCACGGTCCTCGTACTCCACGATCTC
ATTGATGCGGCTCACAAGCCAATCGAAAAGCTTTCCGTACAAAAACCGAGCAAGCGCGTCACGGGCGTTCTCGGCAGCGTCCGGCAGCAAACCAATGGAG
TAGTGCTCGTCCTTTGTCTGAATGTTGCGGTTGCAGATAGCCTGCTCGAGGCCTTGCTTGTCAACCTCCAAGTAGTCGAGCACTACTTTCATCGAGTCTT
CACACATGCTTGAGATCTCTGATCCCTCCGTACCTGATGCCTGGTGGGTCTCCTCAAACTCTAGGTTACCAATGTGAAGCAGAGATGCGATTGTGGAGAA
GATGCTCTCTCTGTCATCCTCGTCGAAGCCCATCGTCTCCATAGCGTTTTTTAGGACCCCAAATTGCTCCGCATCATTCACACCATCTTTACGCTTGACA
CACGTGCTCTGGTTGAGGTAGTGGAACTTGGTCGGCGCCTTCAGGGCCCACCGTTTCTTCTCTTCTGGAGAGGCACCAGCAATGATCTCGTAGAAAATGT
GGTAGTTGCGCTCCGACTCGGCCTGGTACGCGAGACGCACCTTCTCCAGCAAGTACGTCTGAATGGACGCACCAATGAGGTTTCCCTGCGGCGAGAACTC
CATCTTGATGAACTTTCCGAATCGACTGCTATTGTCGTTGCGAATGGTACGCGCGTTACCGAAAGACTCGAGGATTGGGTTTGACGACAGCACTTGCTTC
ATCACGTTGCTGTCGGCGGAGGCGTTCTTGTGCTGCGAGATGGTGGCCAAATAGTTCATGACGAACTTGGTCGTTTCGGTCTTGCCGGCGCCGCTCTCAC
CGCTGACCAGGATGGACTGGTTGGCGGCACTTCCATCAGAGCTGTGTCCAATCGGGTTCATGAGCGAGCGGTATGCCTTGTCGGCGATGCTGAAGACGTG
AGGGGGCATGTCGGCCACCTCATGGCCCAACGCCCGTTTGTCTCCATTGCGTATGTACTTGCGCGTGATCTTCTCCGTGTATATACCCAGGTTCTGGAAG
GGGTTGATGGCCAGCAAGATCTCGCCCGTGAGCGTGTAGATCTCGTTGATCTTGAAGCGCTCGTTCAGTGTGTGGCAGATGCCTGGCTCGTGCAGGTGTG
GCAGCTGAATCAGGTCCTC