Description :
From Genome Similarity Track
Location :
Scaffold_13:94979- 96466
Transcript NameFunction/comments
Aphas_H257_05674non-ribosomal peptide synthetase

Sequence
1487 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCATGAGACTGGCCAATTCGCCAGCATGGGAATCCGTCGACACG
ACGACGTTCACACCAGCATCCGACAGCATCAATGCCAATCGATCAACAGGAAAAGCCACGTCCAGCGGCATCATGGCTGCTCCCACCTTGAGCGTCGCCA
ACAACCCAATGGGAAACTCCAGACATCTGTCCATGACCACCGCCACGCGACTCCCCACACACACGCCCAGCTCCGCCAACTGGCTGGCCACCGTATCCGC
GTGGGCGTTCAAGTCCCCATAGGTCAGCCATTGGCCGTCCAACTCGACCGCTCGAACGTCGGGGTGTTTCGCAGCTCTGGCTTCAAACGCATGGTGCAGC
AGCTCAAACGGCAACGGCACCGTCGGGCCAAACGATGCGCTGCGAATGAGCGCTGTCTGAGCTTCAGACAAAGTCCACAAGGCCAATGAGGTCGACGGGG
CGTCCGAACTGCACAGTTGGGTCAGGGTGTAGTCAAACTCGTGCAAGATGGCTCTCGCTTGGGCTGACGACAGTTTATCTGGCTGGAAACTGGCCATCGC
AACCAAGCCCTTGTCCGCTCTGGGTAGTTCCACGAGCAATTCGAACGCATAATGCTGGGCCACTTGGGTCTTGTGTTTCCACGTCTCAATGATGTCGACG
TCAGCCACGTTGGGTCGCCGTGCAGGCCACTGCTGAAACGCAAACAACGAGTCAAACATTGGCTGGCCATCTGTCCATTTCGCAATGTCCACGAGGCTGG
CGTGGGAATACGCAGACATGGCGTGGTTCGCGGCAGTCCAGCGTTGCAACAGTTGCGTCAGGGGCAATTCGTCGTCAAACGTCACTCGACACGGCACTGT
GCTCAACAACGGGCCCAGAATTCTACAAAAGCACAAGTTTCAGAGGTGGATGTCGCAGTGAGACGTACCTTTCTGCTCCGTGGACAGGAATGCCTCGATT
CGATCGCACTTGGCCAAACACAACGTCGTGTTGTCGAGTGAACTTGCGGAGCGTGGCGGCCCACGAGAACTTGGCCAAGTCCGACGC