Description :
From Genome Similarity Track
Location :
Scaffold_47:94975- 97758
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15328phospholipid-transporting ATPase

Sequence
2783 bases(100 bases per row)
GTCTATTTCAACTATGCACCTGGCAACGCTGTGTTCGACAAATGCTCGAACGTCGTGGTGACGTCCAAGTACAACTTGGCCACTTTTTTCCCTAAATTTC
TCAAGGAAAGCTTCACTAAGGTGGCCAATTTCTTCTTCCTCATGGTCTGCGTGCTGCAGAGTATCCCTAGTATCAGTAACACGTACGGCTACCCGACCAA
CGCGCCGGTCTTGTTCTTCGTCATCTCGATCGACGCCGTGTTCGCCGTCATGGAGGATTTACGACGCCACAAATCGGATAATGAGGCCAACTCGGCCATA
TGCCACGTAATCCAGGACGGTCAGGTCGTGGACAGGAAGTGGGCGGACATTAAAGTCGGAGATTTCCTACAGATCCGCAACCGGGAAGTCATCCCGGCCG
ACGTGCTGGTGCTCGCCGTGTCAGAGCCCGTGGGCGAGCCGCCCAGCGGCATCTGCTACGTCGAGACCAAGAGTCTGGACGGCGAGACGAACCTCAAGCT
GCGCCAGGCGGTGGCCGCGACCATGAGCTCGCTCGCGAACGCCGCCGAGCTGGCGCTGCTGCGCGGCGTCGTTAAGTGCGAACAGCCCAATCCGCACATC
AATAAGTTCGCAGGCAAAGTGGAGGTCACAGTGGGCGACGGTTGCGGCGTGGAGGTGATGCCGTTATCAGTTAAGAACGTGCTGTTACGAGGTTGCAATC
TGCGCAATACCGACTGGGTTTTTGGACTAGTGTTGAATACCGGTAACGATACCAAGATCATGCAGAGTGCCAGTGCCGCTCCGTCCAAATGGAGCGACTT
GATGCTGAATATCAACCGGATGATCGTCATTCTGTGTCTGGGGCTGTTTGTCGCCTGCGCCATGGCTGCAACCTGCTACATTACGTGGCAGTACGACATT
GTACGCAACGCGTGGTACATTCAACTGACGGAAACCGAGAGGAACCGCACGCGTCTCGTGGCGTTTATCCAGATGTTGTTCTACTATTTCTTGCTGTTGT
ATCAGGTGATCCCCATCTCGCTCTATGTGTCCATGACAAGTGTCAAATTCTTACAGTCGCGCTTCATGTCGTGGGACCTCGAAATGTACCATGCTGAAAC
GGACACACCTGCCATCGTCCGGACGATGGAGCTGAACGAAGAACTGGGCCAGATCTCGTACGTTTTCAGTGACAAAACTGGTACACTTACGTGCAACATC
ATGGAGTTCCGTAAGTGTTCCATAAACGGTATTTCGTACGGCTCCGGTATCACGGAAATCGGTCGTGCCGCACTGGTTCGAGCTGGTAAACCGATCCCGC
CAGAGCCTAAACTGGACCCGAGTATCAAGAAGATTCCGTTCGTGAATTTCGTGGATAAATCTCTATTTGACAGTATGAAAGGTAGTGCAGGAGAAGAGCA
GAAGGAGAAGATCATGCAGTTTTTCGAACATCTCGCAGTGTGCCACACTGTGATCCCAGAGAAGCTCGAATCCGGCGAAGTTCGACTATCCGCGTCGTCT
CCTGATGAACAGGCTCTTGTGGCAGGTGCAGCCTTTGCAGGGTTCAAGTTTGAGAGTCGTAGTGTTGGTACAGCGATGGTGGAGGTTCTGGGACAACGTG
TGACCTACGAAGTGCTGGACGTGCTCGAATTCAACAGTACGCGTAAGCGTATGTCCGTCGTGGTGCGTAAACCCAGCGGAGAGTTACTTCTGTACACGAA
AGGAGCCGATATGATGATCTATCAGCGTTTAAAAGACGACCCGGCGATGCTCAAACTCAAAAACATCACACGAGATCACATGGAAAAATACGCAGACGAT
GGATTACGAACACTGGCGCTTGCAGTCAAGAAGCTGGACGAGCGTTGGTTCCAGCAGTGGAAGATGCGGTTCGACGATGTACAGGGTAACGTGGCTGAGA
TTGATCGACGAAAAGACGGTAAACCGAACGCTATCGACGACCTGATGGAGGAGATTGAAGAAGGTCTGGAGCTTATTGGGGCCACAGCTATCGAAGACAA
ACTTCAGGACGGAGTACCGCAGTGTCTGGCTAACTTGACGCGGGCGGGTATTAAAGTGTGGATGCTTACAGGCGACAAGGAAGAAACGGCTATCAACATC
TCGTACGCCTGTTCTCTGCTTGACAACTCGATCCAACAGGTCATAGTGAACGCCACTACATGTCCAGACGAGGCAGCGATCCGTGCAAAACTGAATGCTG
CAGCCAGAGAGTTTTTAGACAGTGCCAAGGGGATGGCAGGTGGCAGTGAGAAGGAGATCTCGTTGATTATCGACGGCGAAGCACTGGAAATGGCTCTGCG
ACCAGGAACGGCGCCACACTTGTTGTCCTTTGCGAAGCTGTGTCGCGCCGTGATCTGTAACCGAGTGTCTCCTGCTCAGAAGGCAGAGATGGTCAAGCTG
GTCAGAGATAACATCACAACAGTACGGACACTAGCGATTGGCGATGGAGCTAACGATGTAGCCATGATTCAAGCTGCTCACGTGGGTGTGGGTATCTCAG
GACAGGAAGGAATGCAGGCTGTCAACTCTAGTGACTACGCTATCGCCCAGTTCCGCTTCCTGGAGCGATTACTATTGGTTCACGGACGTTGGAACTACAT
TCGTATCTCGAAACTGGTACTCTACATGTTCTACAAGAACATCACGCTAGTACTGGCGCAATACTGGTACGGCTATCTGTCCGGCGCTTCTGGCTCGAAA
ATGTACTGGGAGATCGGCGTCCAGCTGTACAACATCGCATTCACAGGTCTCCCTATCGTGGTCGTGGGTGTTCTGGACAAGGA