Description :
From Genome Similarity Track
Location :
Scaffold_109:94936- 125823
Transcript NameFunction/comments
Physo_142162dehydrogenase
Physo_158482hypothetical protein
Physo_158483hypothetical protein
Physo_142166hypothetical protein
Physo_142167hypothetical protein
Physo_142168hypothetical protein
Physo_142169hypothetical protein
Physo_142170hypothetical protein
Physo_122607predicted protein

Sequence
30887 bases(100 bases per row)
GGCTCGGTATTATCGTAATTGGGCTGCAAATGCAATGGTTCAGACTGCACTCCACAACATCAACGAACCGATCGCATCACATGCGTAGCCGCAGCGACCT
GTTCTCTCGCTTTTGTGCCGGCTACTACTTTTGCATTCATCGCGGAGTCATTTCAATACATCTACGTAAGTGCGTAATTCTCGGAAAGTCCACTGCTAGT
TGATTAACGAATTATTTTCTATTTATAATATATGTGGATAAACTCGATCGAGGATGCGCCATCTTGCAGAAACAAAACCGTTCGAGTTGGACGTCATGGT
GGTTGAACCTCGTTACTGAGAAACAAGGGTTATGCAATTCGCTACAGAATAGTGACAAAGCGACAACATTTTCGTGGATCGAACTATGTAAAATCTGCTC
CACCAGGAACAACTGCCTGGAATTTACAAGGCCTATTAGAGTACTATAGTCGGTGAATGTATACTAAGGAAGATTTAGCGCTACACTAGCGATTAAACTT
CGTACTTCCGCCATATGAGACAGCCTCAAACAAAATGATACTAAGTCACCATTAGAGTTATCGAGATAATCGCGTTTGAAGCTGACCAATCACATTTCGT
ACCCAACAGGACATCGAAATCTTGAAAGTTAAAATCACTCGTATTAAGCGAAAAACACTCTAATTCGATTGCTTTTAGCAAAAACTTTCCGGCAGTATAC
AATTCGTAAATTTCGGAGAAATATTGAGCTCACAAGCCCCAAATAAAATCCGGGATTTGGGGGGTCCGAAAATGGAGATATTTGTTTTAAGACCGACGTC
ACTCCGCGAGTTCTTAACATTTTTCATCTCTCAATAGCCACAGAACCCGGCTCTTTCGATCGGTATGCTTAAATCGCGATTCGTACTTTGGTTGATTAGT
ATATTTTTGTTTGAGGCTGTCTCATATAAGGACAAACATCCCATCCTTGTGGTAAGCGTCGACCAGCCACTATTTGTATTCGTGGTGGACTGGGATGCTA
CATAGTTGATCTTACGGTAGGATTATTCCTTCATGAAGTATTAGCCACGTAGTACTGTACAGTGTACAGTGACGTGCGTGAATACCGGACGCCTGATATA
TATAAGGTCTCCAAGAGTATAAGGTGAATCCGATTGGTTAAGAAAAAGGAATGTATTGATATTATTTAGTTCGTCAAGAAATTGATGGCGGTCTTGTTAA
TAAGACCCGAGTGATACCAGCAATGCTGTATGGTATCAGCAGTAACCTTCAACCAGGCGTTCTCACACCACATCAAAGCGGTAAGAATGTCAACCTTATA
AGGCTCATCTACTCCTTCTCCTATTTGGTCGAGCGCATACAACATTTTCTCTGATAATACATACCTCTTGATACAGTGGATGATACCTTGGTCCATAGGC
TGAATCTTGGACGTCGTGTTTGGCGGTAATTTCTCTACCTTCACATGGGTAAGGTTGAGACCCGTCTCGTGGTGAGGCGACGCGTTATCCACGAGCAATA
GGATCTTACGGTCTTTCTCGCGCATCGCTTCGTCCAGAACCACCACCCATTGTTGATACATCCAACTCGTCATCCACCCCTTCTCCGTGCCGAAATATTG
GAGGGAGGCGGGTTTTTGAGGGAGCCACCGTGGTGCCGTAGCAGTGCTTAGATACAGAATAGGCAGTTTCTCTGACCCATCTGCATTCGTGCAAACTGCC
ATAGTTACCCTTGACTTGCTTTGCTTTAAAGCAGGGGCTGCATTCTTGCAGATGGACCCTCGCGGCACTGCATTATAGAAAAATGCACTTTCGTCCATAT
TAAACACATCCCGAGGTCGGAACGTGCTGATGAGCTTCTTTAAGCGTTTCATCTCATCAATGGCCGCGTCCATCTTGGCTGAGTCAGACTCTCCAAAGGC
TCTACGCCACTTCAGACCAAATCGATCTTGCAAGCACCGGAGCTAGGACCTCCCAAGCCGAGGTGCCCGCTCAGCAGGGATGCGAAGCTTCGTAATGAGC
TTTTTCGCGTGCGCAATTATCACCGCTCCGCTGAGGCTCACGCCTTCCGCCTCAGCGAGCATGACGAAGTCGATGACGTATTGGTCGAGCAGAAGATGGC
TTTCGGGCTGAGCTTTCTTGCGGGTAGCTTTTTCGATCGGGCACTGTAGCAGCTTGTCTTTGGCCGGCTTGATGTCGCCTATTGTCGCCTTTCCGGGAGC
AACAGGGAGGCTGAGCTCTGCAGCAGCTCACTCCGCGATCTCCGCGTAGGACATGCTCGGTGAGCTCTCCACCTTGGCAATGATGCGTAGCTTCTGTGCG
TGAGTGAGGCGGAGTCTTTTGCTAGAAGTGGGGTCTTGGGCATGATGGCTTGGTAGTTTGAGGCTTTGATCGCAAATGAGGAAGTGAACGCTTTTAATGG
AAATCAAAGTGGCGAAAGCGCGCCAATATTCAAATTACCGCTGAATACGACGTCACGAGATTAATGGATTTTTAGCTCAGTACCTTTGCTCATCACCATC
TCGTCACATCGTAAGCCCAGAATTATAAATTATACAAAGGTATTAGCTGTGGACCCGTCCGGTATTCACGCACATTACTGTAGTAGCGTGCAACAAACAA
ACGATAGTCATATTGAATACCGCCGTAAACGGTATTAGATTTACTACTATTAGATTTACTACTGCCAACATTGATTGTCAGTATTACTGAATCTTACTAC
TATTTTATTGTACTACTACCCCGGAACAGTGCCAATGATGAGCTTGAAGAGGTGTACCGTATCCGCGATGATGCTCGGCAAGACCAGTCCCAAGTCTTTC
TCCGCGGAAGTTGGCACCTTCTCAATTGCTAAGCCCCTGTGCCCTCAGCCATGCTGCGTCGAGCTTTCTACGGATCATTTGCACGCCGAAGCTTTTCAGG
TAAAGATGCCGCTGTGTGCTAGGATGTGGCTGCTGCTGAGCTTTCTCTCTCTCTCTCTCTCTCTCTCTTCATTGTGCTGCGTGGTGTGCAGCGTCCACTG
CGACGACAGCTGTCGGGTTCATCGGCCTGGGCAACATGGGATTCCCCATGGCGCACAACCTGCTCAAGGCTGGGGTCGACGTGCTGTGCTTCGACGCCAA
CCGCTCCAACGTCGACCGCTTGGCGCTGCTCGGAGCCAAGCCCACCGACTCTGTCGAGCAGGTGGCTGCGCAGACGAACACGATCTTCTCGGTGCTGCCC
AGGGACGAAGTGGTCACAAGCGTCGTGCTGGGAGACGAAGCGAAGCCTGGCTCGGGACTGCTCGCCAACTTGGCGCCCGGGGCGCTGCATGTCGGCTGCT
CCACGATCCACCCGAACACGTCGCGAGCTCTGGACGCCAAGCACCGCGAGGTTAAGACGCGCTACGTGGCAGCGCCGATCTTTGCGCGACCAGACGGGAT
GGAGGCCATGCAGGCGAACTTCGTGCTGTCGGGCTCGGCAGCGGACGCCGTGGAGCAGGCGTCGCAGTGGCTGCACAAGTGTACGAACGGACGCGTGGCG
CCGTTCAGCAACGAAGATCCCGGCGCAGCCAGCGCCGTCAAGCTCTGCGGGAACTTTCTTATCGCGACGGCCATTGAGTCCATGGCTGAGGCGCTCGCGC
TGCTAGAGGCTAACGGCGTGGACCGCGTTCAGGCGATGCAGTTCTATAGCAGCACGTTCCTGAACTCGGTGATCCATAAGGGCTACGGCCAGCGTGTGTC
CGAGCGCGATCATCGTCCTGGCGGCTTCGCTCTGGAGCTGGGCTACAAGGATCAGCGACTGGCGCACCAGTTGGCCATGGAGTCGCAAGTGCCGATGCCG
TTCCTGTCCACGCTCATCGACCGCTTCCTGAGCGAGCGCGCCAAGGGCCGCAGTGACCTGGACTGGTCCGCCATCGGCCTCGGCGTTTGCGAATCACGCG
GTGTCGACGTGTCGGACGCCATCGACCGATCTCGCGCAGGACAAGCGCCACCGCCACGCGGACTCCCGTGACGTACGCAAGGTAGGAGGTTGTCACCGTG
TTTTGGAACAAGCTGAACTTGAATCAAGTCGTCATTTGAAAATAACATCATGCCAGGGGCTGCCAGTGTGCGGGAGTTTGATAGGTAAGGTTCTACCTAT
GTGCGAGTTTGATGAACATGGACCTTACCTCGTCGCAGCGCGCGATGAGTGCAGCAGTTAGATTATGGGCCACACCCCAGCCGATTGCGCTCAACCTTAA
CTCTACATGTAGATGGAGGTGGCGAGCGGGGAATATGGAGTTTTCCGGTCAGATTAAGCTCATTCCGCAAGTTCCTACCAAGTGACCAAGCACCACACCA
TGCCCCTCACCGTTCCTGGCTTCCACACCAACACGCCGCTGGACGCGACCTTCGACAAGGACATCCGCGACCTGCACCTAATCTACGACTACGACGCCGA
GTCGGCGGACGGCAAGCCGGAAAAGTGGCGCTACGAGCTGTGGTTCTTCTCGCACGACCGCGTGGTGTACGCCATCCACGGCGGCCCCATGGCCGGTCGC
ACCAACTACCAGACGTGCGCGTACCAGTGCGTCCGCCCGGGCGAGCTGTGGCAGTGCAACTGGCTGAAGGAGACGGGCACCATTGTGAGTCTGGTGTTCG
ACATCAAGAAGCAAAAACTCACGACCATGATCGCCTTCTCCAAGTGCCACTGGGAGCACCCGGTGGAGGCCCACGGCGACAAGCGCAACGCCTCGGATTT
TGCTCGCTGGCGAAAGCTGGCTGACCTCGGCAACCAGAAGGACCGACTGCTGCTGTGCGAGCAGGCTGACATCGTCGAGGCGTTCAAGGGCAAAGGAAGC
CTGGAGCCCATCGCGCCGGACGCCGAGACGCTGTAACTTGCAGCTTAGGCTGTCCGTCATAGCAGGCAATTGCATAAAGCGAGTGTAGTTTTGCTCCAAA
TGACGCACATATGAATAAGGGTGATAACGTGTACCGATAACTCACGATGAGAATCATCGAGCTTTTTTTGCAAGAAACACATGTACGTTTTGAATGCACT
TCCAACCAGCATGGCGCATTATTGCCACAGCCGGCTGCACTTAATCGCGAGACGCGAGCGAAAATTTTTGAGATCTACGAACACCATCGCTCTATTGAGA
GACTTTACGGAACTTAGCAACTTTTCACGGGTGCATTCATCCTACTGTAGATCTAGGATGATCGACTCGATCCTCTCGTTGCGGACACAAACTCTTGACC
GTGGGCGTTCGTTACCTCTGCGTGTCGCAAGAACGCACCCAGCGCTCCTAAATAGCCCTCGTGCTTGCAAAAGCGAGCCTCCATCGCTCCGTTCGACCAA
AAATTGATAGCGTACGCCAGTGTCCGTGATGAAATCTTGTTGTGCCGGAGGAAGTTGCCAACGAAGAAAATGTTCTTGGTCTTGTACAAGGTCGCGTTCA
GAAAAGCGACCTGACCAATGTTCTGGGTGATCATAACCAGCAGCGACCGGGCCAGATCCGCTTCGCTCACGTTTTCGCGCGAAGTCGAAATCATTTTTCC
GAAACTGCTGGCGACGGTGGACGCCGGCAGCTTAAACTTGTCGTACGCGCCGCCGTAGATGTCCCCCACGCTCATATCAACCGTTTTGTTGGTACCGTGG
ACACACAAATCCAACGCCTCGTCGTACGATTCGCAGTGCGTCATCAGACGACAAAGCCCCCAGTAGGTGCCGCCGCCAATGCTGCTACCGCTCACACGTT
CATAATCCCCGGGGGCCTTCACATATAGGACACTTACACCAGAGCCAATACTGACCAGCTGCAGCAATGTTAACGAGTTAGAATAGCTCAAAGTCAGCAG
CAGTGAAAAAATGAGGTAAGAGGCGTACCAGATACGGGTACACATCTTCGTTCACGTCCGTCTGGATGACCTTCACCCGCGAGGCTGCGAGCGAGTTAAA
GTCCACAACCTGCACCACAGTCAAGAGAAAAAAACATGTCAGTTTCGACCTCAAACAGCACACCAACGCTCAGTGCGTACCTCAAAGGTGTACACTTCAT
CGGACAGCGTCGTAAGCAGCAGATGCAGTCCCAAAATGGTACAGTCTATCTCGTCGTACTTCTCGAGCTCAATGCCAGCCATCTCGTTGAAAACATGTCC
GTACTGCGCACCACATACAACAACGTCAATAACCCGCGTTTGGCGCTCAATTGCAACCCGCAGCTCGAACCTTGTGGGCGCCTCCGCCCGTGCACGGCAG
GATCCTCAGCGACTGGTTGATACCTTTGTTCGCAATGAACTCGATCGCCTCGCGCGTCTTGTTGCTCTCGAACCGGACAAAGTGGAAGATCTGCAGGCAA
CAGACCAATGAGTTCGAACAGCAACCCACAATTGCAGCTGCAGCGTCCGCGTACCCCGTTGAGCGTCTTGGAGTGGATTCTCAGCCGCACGTCCTGCACG
CCCGTGCTGCCGAACGACTGGTTCTCGCGCAGGAACTGGTTCATCTCCCCGGCCGCCACGTCCAGCGACGCCGAGCGCGGCCGCTTGCGCGTATCGTTGC
CCACGTCGCGGCGCTCAAAGTACACGATCTTGGCTAGCGTCCCCCCTGCAGCAACAGAGAGATAGATACACAGCCGTCAGCGAGCGTATCAGAAGGCGGA
TTTTTCCTCCTCTCCTCACGCACCGATGTCCAGGCCGAAGGACGCGCCCAGATCCGACCTGCAGCAGCACGTAAACGTTAGAGGGCGGGAAACCTAAGTG
GTAGGCATTGATACGCGTCTATTTCGTACGATTTGGAGAGCTTCTTGTAGGTGAGACGCTGGCGCCACACGCGCTGGCGGTGGCGCTTGCGCTCCAGGCA
GAAGAGCGCCACGGTGGACGAGAAGAGCAGGAAGCCGCCCGCCAGCAGCGCGCGCTCGGCGCCGACGCCGCCGCCGGCGCTGGGGGACGGCGCCAGCATC
ATGCTTGAACTTTGACCGCTCCCCCAGTATGCGTCCGCTGATTGGGCGAAAGCGGAGACCACTTTTGACGAATGACGGACGCTTTGGCCGATTTTGATCT
CTTCAATCTTTGATGGAGCTTCTTGTAGTGATGTTTTGCTTCTGCAGCTATAGTACACATAGCTATTCGACCCAAAGGTTCATTCATATCTTTCAGTTGG
AATCAACTGCAGAGGATTCCTTCCTTCACCCCGGCCGAAGCCAACGCCTCGCGCCGGTTCCCGTGCGTCGATCAATGGATCACCCGGTTGGTGAGCCGAG
GCGGGGCAGCCATCTGACATCCAAGCCAAGTCACACGCGCGGCAGCACCGCGCCCCGATCCGATCTGCGCCGCGTGCAGCTTGATCTGCGCCGCGTGCAG
CTTGATCTGCGCCGCGTGCAGCTTGAACCCACACGAATCGTCGCTCGCCGGCAAGATCGCTGCGCGCCAACCAGCGTGATGGCAACAAAATCCCGCCACC
ATCGACGCGAGTTCCTCGCGGCGCGATAATAATCCAGCCCCCGGCAAAGCGCTGGCAAGATGTTTCGAGTAAAACCCGACATGTCTTTCCCGATTTTTTA
GAACCAGATGACGGCGTAGCCTGCCCTGCAATTGCATACCCGTCAAATATGATGGTATCGGCTTATACATGCCAGATACAATCGCTGTTTCCGCAGACCT
CTGGACTGCAGGTCCGCTCGCAGGTGTAGGTAACCAAAAAAGAATTCACTAGCGCGACGCTACGACGGGCGTGACATCTAGGTATCAATCAGGCTTGAAG
GGCAGTAACAGCCGTAGGACTTCGGTGCCGGCACTGGCAGCTTCGGTGTCATTCCAGCATTCGCCCGCTAACACCGAGAGCCCCATGATGTCCAGCAGCA
GCAGCAAGCTGCAGCCGCCGCGCCGCGTGGTGCGCCGCCCGCTGCAGTTCGCGTCGCCCGCCAAGGAGCAGCAGTACCGCGCCGAGATGGACCACGTGCA
GCGCTACATCTGCGCGCAGGTGGGCGGGCTCGACGAGGCCTCGAGCCTCCTGCTCGGCGTGCACGACAGCCGCTCGCGCAGCCAGTACGAGGAGATCCAG
GAGTTCCTCGAGCGCAAGCACCAGCTCGAGCAGCAGCAGCAGCAGCAGCCGAAGCCAGTCGAGCGCGTGCTCATCCGCAGCCTCGACGAGTACCTGAACG
AGCTGGACCCGAGCCTGTTCGCCGAGTGCGCCGCACCCGTCACCCCCAAGCGCCTGGGGGTTGCCAACCTTCCAGCGCACAGCAGCTACATCCGCCGGAA
ACAGGAGGAGGCCAGGCTGGCCCGCTTGTGGAACCCCGAGCACTGCTCGGTGCCCGCCATCCCGTGCGGCGGACCCCTCAAGCGCCAGCGGGTCATGTGA
ACGACAGCAAGAGCCCCTCCAGATAGACGCGGGCGCTTCCAGGCGCGGCGGGTGATTACGGACACCGTGCTGCCATGCGAGCGCTCGATATGCTAGCCAG
AGACTATAATAACAACAACAGTAATTTATCGCCCTCGAGGCCTCCCTTCCTGCCGTAATCGTACGTATCCACGCCCCGGCCTTCCGCGACGATGAGTGCC
CAGCTCATGAGGAAGTGCAACGAGGGCAGCACACGCATGCACGCAAAGTATCCAGCGGTGGCGTCGGGACCTACAATAATGAAGGCGGAGTGTTGCCCGC
TGCAACGGCGACAACGCACACAACACACTTGCCGCCTCGCGCAGCGCCATACCGTCAATCATCGCCAACGACTCGATGGCTGCCAGGGTTTCAAAAGCTG
CAGCGAGGAATCTTCGCCCTCTCGGACTCGATTTGCCCGGCGATGGTTCGGGATCGGAGCTTTCGGAATCCAAAGCGCGGATACATGTACAGATGATTGT
GATCCGACTGAAGCGCTGCCAGCGCAATCCAGTCTTCACCTGTCGTTCTGTTGTCTGCGTGCCACGCCGCGCTTTCTCATACCGCGGCGAACCTCAAAGT
GTATGTAAGACTCACAACGACATAGGGCCCCCAGTAGGGGCCCCACTGGCGTGTGAGTAAAAGTACGACACACATCCAACTTGTTGTTATTTGGCATCGT
TACCTGCTATATCCACAGATACATGTAGCACCTTAGCCGCGTGGAGGACATCGCTAGCATGGCGATTGTGCTGTGCAAAATCCACTTGGATTCCTAAAAC
TGCTTTGGCCGAACAGCTCTACAGCGCTATGTATCTTCAACGTCGTATTTGTTGCATGACAATACGGTAGATTCGTCACCGTTCAGCAAAAAGCCTTGTC
GCTTTAGTTTGTTTGAACTTCTGTACCGTAGCCATTCGTCGTGGTTGACTAGTGACGTGATCCCATCTCGTTGTGTACGGTTGCGTCCATTGCCGTACTG
TAGCAAAATCTGGAATATTCAGTTTGTTGCGTTGCATGTATTGTAAAGAAAGATTCGAAGTCATTTCCGCGTATAAGCTGCAGAGAGCCTTCGCTGAATC
CACACTAACTAGTACAGTACAGATATTCAGTTCTAAAGCTGTTGCGGGTCTTAGCGGTATAACCACTTCGATGCTATTAACATTTTTATCATTTGTTAGA
TATTTCGTAGTAGTAATACCACTCGAAAACACAACTCACTAGTACTGTGTTTACCAAGACAAATTATTGCCCTAGAGCCCCTTAAACACTTCTTACCGTC
TTTAGATTCACTTTTTGTACGGTCAAGCTGTGACACAGCTCCGCTAATGATGCGTCAAGGCCCAGTTTCGGTACCTGGTCACGGGTGCTACTTAATTGCG
AGTACACTTCACTGACTTCCGAGTAATTTCACATAAACCTTATTCGTGGCTTAGGAAAGGCGCCACGTCTGGCATTGCCACCCTGGATGAGACCGAAGGA
AGACTGTCGAGCTCAGCTGGCTCAAGTTCGTCGTGGGCATAATCGCCAGTGGCCCAAGCACAATCATTGGAGCCGATGGCTGCGTGTCTACATGGTTACG
ACGCTGTGAAGGACGGTGACTGGAGAAGGACATTGGGCCAAGCATCACAGAGCGTCATCAAGGGCCCTCGCCGCAGAGAAGCGGGTGCAGGGCCATGAGC
AAGCGAAGGAGTAGCGGACGGCATGCACAGGGCCCCCTTGTGCCCCAGTAGGCAGCCAGCTAGTTGCTTCCGTTTGTCTACCTAAATACATCTCACTTTC
CAACTTACCTCTTCACGAGCAGGGCAGCTCGTGCGATAAAGTTAACTTTACTTCTAGGCGTAAGTTCGATTGCTGGCCTCGAGTGCGCGTCGTCGACCCG
AGACACCCGAGTGCTGCCGAGTTCAAGGACGCTCCGACCAAGCTTGTGACCAAGCCCCGTGACAAGGCTCGCCCAAGCTCTTCGCCGCCCAATGGCCTCT
CAGATGATGGCTGGCGGTGGTTTCGCGATGGACCCTGAAGGCGATGTCAACATGGACGCTGGCACGTCGGTCCCGCAACCGATCTACGAGTTCGTGCGGC
CTCCGGAGCTGGCGGACTGGGAGCATGCGGCGCTTGTCGTGTGGTACCGAGAATGGAATCACTACGTCACCAAGATTCGCCATCGTTGCAGTGTGACTGG
CGAAGTGTTCACCCACGTAGTCGCTACGGTGAAGGGCTCCATTCGACCTCGGGTGTTGGACACGATCGCCACATTCCTGTTGAAGCGCCCACTGGAGACC
ATTAGCGATGATGACCTCCTACGGTTGATCAGGGTGAAAACCCAGTCCCTGACCAACGCGTACGTCCCGGACGTGAAGTCACTGTTCAGACAATCATTGC
GCATGGACCTGCGAGTCGAAGACTGTGATGCCCGCATTTTCCGGTACTTTCAAGACTTCAAGCGGATCGAGGAGGAGAATGGACTTCAGGGTCTCATTGG
TCGGAATGACCCCACAGCTACGACCGCATGAAGGCCAGAGGCCGACTTCTAATTGAAAACCTCCAGCCGGTCGTCTTACGGGAGCAGATCGAGCGCCTCG
TAGAGCTGGAGAGGCGTGAGTGCAAGGTGGACGATGTTGCGCTCTTCGAACTGGTGCTGGAACATGCTAAGGTCCAGCAGAGATTTCACCGGCTGGTGCA
GGAGAGCACACCTGCGCGTGGTGCAACCCGTACGTCTGCTGGAGGCTCAAGTGGTGGTCATGACTCAAAGAAGTCCAGTGGCCAATCGCGGGAGCAGAAG
AACCGACCACCCCCCAAGCGGCGGCCACGAGTGCAAAACCAGAAACAAAACCGCCGCGCGCGTCCAAGCCGCCGACGGAGGGATGTCTGTTCTGTCATGG
ACCTCACTGGCTTCGAGAGTGTCCGACGGTGACAGTAGAGCAGCGTCGTGAGGCGTTAGAACGGTTTCGAGACTCCAAAGAACGGCGTGCCGACGTGGTG
CGCTCAAAGGTGGTCAAGGCGCGTCCGACTGCGCGCTCGGTTCAGATCAATGGCATGCTGGAAGTGGCGTACATCCCTGACACTGGTGCCGACCGAAGCG
TGATACCCAGCTGCGTAGTGGATTCACTTCGTTCGCTACAACCTGACCTCAACTGTGAGCAGCTCCACACTCCCGTGGAGGTGGTGGTGGCGGATGGCCG
CCCACTTACGTGTGGATCAATGGTAACCGTCGACCTAGACCTGCAGACGGCGGCGGGTGTTATGCATCTTCGTGATGTCCCGTGTGTGGTGATGGAGAGC
GATGAGGAAGAACGGCTCGTAGGCCGTGACATCCTAAGCACTCTCGGTATTGACATTGATGATATGCTCGCCCAATTGGCCGTCGACGGGATGCCAGCCG
AGGTGGACGATGGAGTTGCAGTAGGTGATGACTCGATGGACCCACCGGTGTTTGCTGACATCAGGCCGGAGCTGGAGCGGCTTGTTAGCGATGCTGTAGC
GAAAGGACTGGATGCCGAACACGCGCCCATGCTCCTGGTGCTGTTGTTGGAGTTTCCGGACGTATGGCAGGACAGCCTGGGAGGAGGCCCCCCAGCGGAC
GTGGAACCGCTGCGAGTTGTGACGCCATTCCATACCGCTGCAAGCAACGGAAGTATGCTCCATTGCAGAGCGAGTTCCTGCGGGAGCATGTGTCGAAGCT
GGTCGCAAGCGGTCTGGTGCGCAAGAACAGCGGAGCACGCTGGGCGAGTGCCGTCGTCCCAGTGCGTAAGGCGGGATCTCTCGACGAGTTTCGAATGACT
ATTGATTACCGCAATGTGAACTCGCTGACCATTCCGATTGCCGGGACGATGACGAACATTGCTGCGCTGATGAACAAGGTCAACGGCGCAATTGTGTTTG
TGTGGTGAAGCACCGAACAAGAATTTCCAACTGCGATGACATCAAGCGACATGGTGGCAGAACGATAGGCAGGGATCAGGCTGCGGTCGCGGATCAAGAG
GGTCTATCGAGAGATCTCAAGCGATTGGATAACGTCGACGCGTAAGGCAACACATATGTCAAGACAGATTACGGGCGATCGCGCTTGGACTGCGGCGTGA
TTCGACGTAGACCCAAGCCCGGATCGACGACCAATCTCGCAGATCTAGGGCGGCCGAGGACAGAAGAGGACGGATCGGCAGCGCACGGCAACTCGCACAG
GTCATCGATCGGGAGTTGATCGCCGATCGGGATCGATCGTGGATCAGGAGCCGATCGTGGATCAGGAGGCGATCGTGGATCGTCGATCGACCCGGATGGG
AAGCACATGGGGGCGAAGCCAGGGCAAGAATCCAGTAATCGTTTGGTTGTAGGATGGTAAGCAAGATGGTAGCAGTAGGGAGAGACCAGCTAAACATAAA
TCAGAAGAGAATTTGCGCGGTACAACGCAAGTGGCCTGGAAACGTGGCGAGGAAGCACATATTGGCCTCGACCAGCGTACGTCGTGGGGAATCTAATTGG
CCCCACCCGTGATCCAAGACTGCCGAGTCCCTGCGATTCCTTCTCGAGAAGAGAATTGCACCAAAGAGCACAAGTCCCCCAAGTCGTCAAGTCCCAGAAA
CTACATTGGCCTCGGCAAGCATCGACACTTTGGACAGTGAGCTAGTGGTACGGTTAAGACTGGATTAATACATTGGCCAGCTTGACCTACTCTAGCCATC
TATGTCTTGTGTGCGAACCCCCGATCGACCGGATACTGCTCGGGCGGCGATCGTTTCTCCTCTCGATCAACCTCGATCCCGCTATAGGAAGCGGCAAGCA
ACCCAGGAAAGGAAGGAACACACCCGGAAAGGCAACTACAGGCCTTGGATCGACTCCAGGCCGACCGATCGCAGCGAACAACCCTCGATCGGAACGTATA
CTCGGACGCAGAGCGAAGATTCCCGCGCTGCTCCACAAACTATCCCCGGGTCACGCCAAGACACTCGATCTTCACCAAGTGCTGCATCTTCGGAGCCCCG
AGAGAGCAGATCCAGCCCGCCGACGGGTACCCAAGGTGAGAACAAGTTCAGCCGATCACGGGTCGTTGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCG
CTGGTGGGAAGCTTGATCAGGCCTTAACCAGATTGTGGCCGATCCCGCTACACCACATTTGCGTGCTTCGACTTGAAGAACGGCTTCTGGCAACTCCCCC
TCCATGAAGACAGTCAAGAAATCCTGTCGTTCATGACGGAGGATGGTGTCTACACACCCCTCAGAGTGCCGCAAGGGCCATGGACTCCGCCCTCCACTTT
CAAGGTCAGATGCGTGAAGTGTTCGGAGATCTGATGCCGGATCACGTGGAGGTATGGATCGATGACATCCTCCTCTTTGCCAACGACATTCCGACGTATT
TCGCAGTGCTAAGGCAGTTCTTCACCCTTCTGGATGCCCACAATCTGAAGCTTAACCTGGCCAAGAGCTCGCTCTTCACGACCGAAGTAGTGTGGTGCGG
CCGTGTGATTACTGGTGACGGAATCCGTCATGACCCTGCCCGGATCGACGCGCTGACGGACCTTCCATTGCCCTCCACAGCAGCGGAGCTGCAATACTTT
GTGTGCGCGGCGAATTGGTTGAGGGATTCTATCGTGGACTACTCTCGAAGATTTGCCGCCCTTTACATCAAGCTCGAGTAGGCCAGGAAGCAGATTGGCA
AGCGCAGCAAGAACGCATTGAACATTGCGATTGCTTGGTCCGACGACGAGAAGCAGGACTACAAAGACGCAATTGCTACAATTCGTGACTCGGCCATGAT
GGCCTTTCCCACGGACGAAGATGAGGTCTGCGTCTTCAGTGACGCCTCACGACTTGGCTTCAGCGTGGTCATCACGTTGGTGCATCACTGGGATGCCAAT
CTCCCCGTGGAGGAACAAGAGCATGTCATGGTTGTATGCAAGGGTGGCCTCTTCAAGGACTCCCAACTCAATTGGACCATCACTGAGAAAGAGGCCTACC
CCATCGTGATGGCCTGCAGCAACCTGAGCTACCTACTGTTGCGCCGGCGTGGATTTCGACTATTCTGTGACCACTCCAACCTGATCTACCTGTTTGCCCC
TCATGACGATCTGAAGCAGCACGTCCGCGATCGTCTCCAGCGCTGGGCGCTCCGGCTGAACGCCTACCGCTACACAATCGAGCACATAGCGGGCGCAAAC
AACCTCTGGGCTGACATCGTGTCGCGATGGCGGCCTCAACGCGAAGCGCAGGCCACGGTGCACGCTCGCGCGGTTCGCACGCGCAGAGGAACCGCGGTGC
CGGTGGACGACCTCTCCCGGCTGCGCCCACTTACGGATGACAACTTCCAGTTCCCGATGATCGACGATGTCCGTGAGGCACAAGAAGCTGCAGGTCGCCC
TCCAAAATACCTTGCTTTGGTGGAGGAGGAAGGATTGCTAGTGCGCGAGCACAAGCCATGGATTCCAAGTGGAGCCACTGACTTGCTCAACAGGGTCTTT
GTGGTGACGCACTGTGGAGCTCAGGGCCATCGAGGCATTGAGGTACTGACATCTCTTGTCGCCGACAACTTCTATGTTGACAAGCTGGCTGAAAAGGCTA
CTCGATTTGCTCGCGGATGCCTGCTGTGCAAACACGTCAAAGGACCGAGGCAAATTCAGCGCCAGTATGGACCAACCTTCACGGCAACTCGACGGAATGA
GGCGCTGCATTGGGATTACCTCTCGCTCGGGGAGGGCTACGGTGACAACGCCTACCTGCTGGTGCTCAAGGACTCACTGACGCACTACTGCGAGCTGTAC
CCATGTGGCAGTGCTACTGCCTATATTGCCGCAGAGTCACTGCTTGACTGGGTGAAGCGATTTGGCCATCCCGACATGCTGATCTCCGACCAAGGCACTC
ACTTCCGCAATGAAACGGTTGACCACTTGTGAGTAGCGTCACGATTGCGTTTCGATAGCAGCCTTGTGTAGTAGCTGAGAGGTACATCAAAGGCGGAGAC
ATACACTGGCCGTGGTATCGATCGGATCATCTCAGGCACCGACCGCACTGGGTAGAAGCTGCGGCGAAGCCGCTTGTTGAGCTGGCGAAAATCACACACC
AGTCTGACCGTTCCATCCTTCTTCGGGATGACGAAGGCTGGACCACTTGTGTGCCCGCCTGAAGATGGACCGCTCTTTCTCTCCGGTGTACACGCCTTGG
GTGAATGGGACGATTGAGCGACTGAACAAGGACGTGCTCCAAGTCTTGCGCGCACTGCTCCTTGACTATGGTCTGGATCGCCACGAGTGGCCGTACCTAC
TGCCTGTTGTCCAAGCGTGCCTCAATCATGCGCAAGTTCGATCCCTTGCCGGACACTCGCCCACCGAGCTTTTCACTGGTCTCAAGCCAGCGTCGCCGCT
GGATGTGATTGTGCGCCAGACCCCTGCTGGGGAAGAGCTGGTCGTGGTTGACCCGGAAGATGTTTCGCGTCAGATCGAGAAGCTGCGTGCGTCGCTCGAA
GGCATGCACAAGGAAGTCGTGGACAAAAAGGAGCGCCGAAGGCTGTTCGACATGCAGCGCAAGAATGGGGCGGAATGCAACTTCGATATTGGCGACTTTG
TGCTATGGTCGCGTATTGACCAGCGCCTACCCAATGACAAGCTCCTAGGCCAATGGCTGGGTCCCTTTCGCGTGGTGGAAACGACTCCTCACGCGTTTAT
TATCGAGCATCTCACGAGCGGGAAGAAGCACGAAGTTCACGGGAGCAGACTCAAGTACTACGCCGATTCTGTCTTGAACGTGACGCAGGAGATGATCGAG
CTCGTCACCGCCCAGGGCATCGTGCTGGACGTCAAGGCCATCGGAGACCACCGTTACAATGACGTCTACCACCGCTGGGAGTTGCTAGTGTCATGGCCTA
GGCTGCAGGAGATCGAGGACTCGTGGGAGGGCTTGGACGGGATGCTCAAGGACGTCCCTCAACTCGTTCGTCACTATGCTGACTCATCGGGCGATGACTC
ACTCATAGCGCAACTCGACTAAGCGTTGCTGGCCCTCGCCGAACAAGAGCTTTGGAGAAGGCGGTGTCGTGCTCAGCTGGCTCAAGTTCGTCGTGGGCAT
AATCGCCAGTGGCCCAAGCACAATCATTGGAGCCGATGGCTGCGTGTCTACATGGTTACGACGCTGTGAAGGACGGTGACTGGAGAAGGACATTGGGCCA
AGCATCACAGAGCGTCATCAAGGGCCCTCGCCGCAGAGAAGCGGGCGCAGGGCCATGAGCAAGCGAAGGAGTAGCGGACGGCATGCACAGGGCCCCCTTG
TGCCCCAGTAGGCAGCCAGCTAGTTGCTTCCGTTTGTCTACCTAAATACATCTCACTTTCCAACTTACCTCTTCACGAGCAGGGCGATAAAGACACAGCA
TGAATGTATCTGGGGAAGTAACGCATCGAAACACTTATGCGGATATAAGGAAGCTAATTGAGAATTTAAGCGTTATCCAGCAGAAAACATCAGACAAGTT
GCCCTAAAGGGCTAGTAGCACGTTACTTACGTTCGTGAATGCCACACCGACATTCAACGTTCTTAGAGCGGAGTCAATAGCTGGAAGCTAACGCAACGCA
CGAGTTCAAAAGAGGTATATGTACTCGAAAGTCCGGGAAAATTACTCTTTACTCGACAGTCCGCGAAATGTACTCGAAAATAAGACGACCCCCTGATCAC
GCTGCTGCTGTCACTCCTTCAGGGGCACTCTAGTCGAAGCTGCAGCGGGTGGGTTAAATGAGCGCCCCCCCCCTCCGTCGCATGTTTCGATACAAATCAT
GGGAGCCCATACAAAAATCAAGATATGGTCATGGCTCAGCTGTATCGGGTGCTCAACTCAATCAACGATTTGTCAAAATACAGGCATTAATAGCCAATGA
AATGGCAGCTGATTATAGTTCAAGCGATTCTGCGTCGAATGGGGCAGGTTTGATGTGAAACCAAGAAGAAATGACAATTCTGTAGTATGAAATGTCAAGC
CTGCAAATCATTTGACTTGATTTTTGTATATTTTTTTGCAAAGGGGGGGGGCGCTCATTTAAGCCACCCACTGTATATCGACATTCTCAAATACGTAAAT
GTTAGTTGGGCAGTTATTTCATCAGGGCACGGACTGTCGGGAATTCAGCTCTGTACATAGCTACTGCCTGTGCCATCCTATTGTATCCATGTTTCGGTGG
TGCTTACCGCTAGTTGGCCACATATCGTTATGAGTCTGTACTACATATCCCTCGTCGAGAACTTCGCCAACCTGAACAGAAAGAAGAAAAGTCATAGTAT
TGGAGTGAAAACATCATTTTCAATTTCAGAAGAAATTACTGCGGACAAGTCTCCCCTGTCTACAAAAAGTAAATATAATAATAATACATTGTCGACAACA
AGGAGACGTAGGCGGGTTGAGCTCACCCGGAGTGCAATCAGCGTTAACCGCGAAAAAATAACTTGATGTAGTGCGAGCCTACGACGACAGGCGTCAACTG
TCCATGGCGCCCGGCTCGGGTCTTCGTGAGTGGTGACATTGGTTACTTCATTATAGGCGATCAATCACACTATTTCCAGTCTACAAACTCAAGTATTAGG
GCGTTTGACTTGGGGATTTTGGCTCAAGTGTTGCGATGATTTTGGATCCACGCCAGTGTTACTCCATGTGAAGAACCAACTGGGTAAACTCCGTTGAGTC
AGAGCCGCATTCTGGAACTTGCACATCTTGCAGCTTATCAAAAATAACTTTCGGGATGTGTAAAAAAGTTGAGAGCGAGTACGGTACTATCCATTCGCTG
AATCAACTCTACAGAGAAAAATTACCGACAGGAGGCGTTAGATAAGGAGAGCTGGAGGGCGTACGCTTGTTTGAAGAGGATCGCTTTAACCTTTGACCTG
CTGGCTACCGTATACAGCAGCCGTGTACAGATCACCGTTTTCTTGTCGACTTGTGGTGCGTACTGATGACCCTCATTTCCTCGCTTCATTGCAGCCCCAG
TCAGTTTGTCATGTAGCAGAGAACCACAACTCGATAGTTTGCTTTCGCCTTCTTGCCAATACATGTACGGTACATACCAGCGCTGCATATAAGGTACCTT
CAAGTTGGACGTAGCTTGCGTGGCCTGACCTTCCTGCCTATTACCATTTTCCTTTAGACCCAAGAATGAAGAAATGTTGGAGTGTAAGCAACAGGCGGAC
CATATAGTGATTATGGGTATGGTAATCCCGTAACTACCATGCATGGACGTCGTGTCGTAACCCAACTAATATGTATCAATAGGTCGCTGCATAACTATTA
TACATGTACCCACGCAGAATGACATGGTGTTGTAAACCACAACTACTTACGTCGTAAACCATACATACAATACGAACCGCATTCGGCATACAAACTCTGT
GTGCATTGAAGTTTTTTTCTTTCAAAATCCACGTTGTATTGCCAAAGCCATTTTATTAAGCGCACTAGGATGCGACTAAATCATGAACGTAGACTTTTTC
TCGAACCACTAGTATTGGTACTGTGTACGTAAAAATGTCCTAGGAAGTTTGGAACAATAAATACTCGTACCGGGGAGGGTGGCGGAAGCTTGAAAATGAC
CAATGCATGACTGACCTGAAAGAAAAAAATAGTCCAAGTTTGCGCTTGGGTTTTGGAGAGAATATATACTCTTGGAATATGAAACAGCGTAGCAGCATGT
ATTATATATTGCAGCATTTTTGCGGACTCAAACAACAACAGTATCCAAGTTCTTCCAGTCAGCGCGATGCTGCACGTGAGTCACCCACTCGATCGTCCGG
TCGCAGCCTCGACCTTGACACTTCAACTTCATTATTTATCGTGGCGTTCGACCTGGAGACAGCAAGCGTTCGGCATCGGAGGTTGATCCGTGCCCTTCGT
TCCCGTGAGATGGGAAGTTACTGCCAGGTGGCACTCGCTCGTGGGCCAGCTATTACCGGTACGCTGTTGACGCGGCCACATGGCCGTACGTACGGCACCA
TTGTCGAGCAGAATGTAATCTTGCTCAGGCACCAACTGCGATGGGTACCTCCACAACCACATACTATACAACTAATGTATATGTATTTACAAAGTATACT
ATATTTCCTAGGTAAAATTATCCGTTCTCACGTCGCCCACGGCGCCAAAACCCGGTTCCACGGTGCTGACAAATCTCAAGAAGTCTTGGGCAGGACAAGC
CGCCGGCGCCTCAGCGAGGAAGCGAGCGAGCATGTACCATGGGGCGCCTCGGGACCGCGGGGACAAGGTGCCGACTCCCCCCCTCCACCTCATTCTCCAC
CCCCCCTTCTTCTCCCCCTCTCTAACCTTAAATCTATGTGCGCATACAAACTTCTACGAATTCTCTCTTTTTCTCTCTTAGCGCCAGCGCCTCACGCCCC
CGCCCAACGAAGTGTGGATGGAAGCCATCATGAGCAAGGGCAAGACACAAGATGGCTACAGTGCGGCGCCCGGCGGCGGCGTGAGCTCCGCCCCGTCTTC
AGGCGCCGCTCGGCAGGGACGCGACAGGCCGGCGCCCGGCGGCGACTGGGAGGGACCCCCACCGTCCTCCGCGGCCTCTGCTCCGATGCAGTTCCAGCAG
TACGCTGCGGGGTACGCTGGAAGGCCGGTAGAACGCCCTGCGCCCTACCAGGGGAGAACGGCGGAGCCTCCCGCTGCGTACCAAGGGAGAATGGCGGAGA
AAGCGGCGGGGTATGCCGGGATACCCCCCATGGACGGGTACCAGGGGAGGCCCCCCGTGGAGGGCCCTACCCCGTACCCCCAGAGTAGAACGATGGAATA
CCAAGCGAGGATGAACGACTCTGGAGCAGCGGCGTATCAAGGGAGGACGATGGAAGCGGCGGGATACCAAGGTAGAATGGTGGACAGAGCAGCAGGATAC
CAGAGCAGACCCACCGGACAGGGTAGAATGAGCGATGGACCCACAGGATACCAAGGTAGAATGGGCGAGGGACCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTCCCGAGTGGAGGAATGCTGCGCGAGCAAGTGAATCTGGACGAGTCGGTGCTGCACGACGCGTTCGCAGTGGCGA
TGGAGGACTTGATCCCGGAAAAGGAGGCCAACTTTGTGGCGAAGGGGCTGTGCCACTTGTGCGGAGTGGGCGAGAATCACTTTGTGCCAGTGGTGAACTT
TTGCCCGCACGCTGACGAGAACCACTCGCTGTGTCGCGAGCACTTGCGCAGTGTTTACAGGGTCAGGATGGAGGCGCTGTTCGTCGGCCGGAACGGATCT
GCGCCCAACCGACGTCTGCTGCGCTGCCTGATTTGCACGCACGGATGCCCGTGCACCGGATGCACGGCAGGGAAGGAGAAGGAGGTGCAGAAGTACAAGC
GCTATCTGCTGGATACGCTGCGTCGCAGTGGACAGGGCTCAGTGCCTGCGGGGTCAACCGATCGCGCTGCTGCTGCTAATGCTGCTGCTGCCGCCGCTGC
GGCCGCTGCTGCTTCAGCATCGACTTCCGAGGGGCGACCGGCCTACAGCAGTGCCCAAAACATGGCTCCCAGCGAGGGCCGACCCGCACATAGCAGTGCA
CAAAGCGCGACTTCTAGCGACGGACGTCCCGCATACAGCAGTGCTCAAAGTATGGCACCTAGCGAGGGACGGCCGGCATACAGCAGTGCTCAAAGCATGG
CTCCTAGCGACGGACGACGTTACGCGCAATACCCTCCCACCTCGTCAGCGGAAGGCCGTCCTCCTATTCAGCGCGACGGGTTCTCGGCTCGCAATGCGGA
ACCAGGAAAGCCGGTTGAAGGACGCAGACAGATGCAGCAGACTCAGCAGCCCGAGTATGAGCAGTACCCGCCAGATGAGCGAAATCGCTCCGAAGATTAT
ACCAGCATGCAGGCTCAGCAGAAGTCTCCGTCGAAGTACCCTCCCGTTCCGAAGCGAGCGGCCAAGGATGCGCCCGCTGATATGCTCACAGTGATGGCTG
ATAGCGCGCAAGCCACTGATACCCGAGTTGCCGCTGCGAAAGCTGCTTCACCGCGTGTTCACCCAAGCTCTGTGGATTCCCCTTCAGCGGCTACTGTTAT
GAATTGTGCTGAATCGGAACAGTCTCTGGTTCGGCTGTTGAGTTCGCTGAATCAAAACGGAACACCAACGACCTCGGCAGCGATGGATGCTAGCGGCCAG
CCCGCTGGTAAAGACGGCAGTCAGCCCCCGAGTGAATCGCGCTACGGTTCGAATGGGATTGCGCCGAGGACTACAAACAGCGGGAATGCGCAAGCTTCTA
GCGAGGCGGAGGCGTCACCTCGGGTGTTTGCTCCGCGTGGTATCGCCGACAGGCGCTGCCAAACAGACAGCCCGTACCAGGATCAATCGTCCACCAGCTT
AATGGACTCGGGTGATAGCACTCCGCATGAGCGTTCGAAGACTGGCGGCGTGCGGCCTCTTGACGTGCTGAAGACACGCAAGCGGAAGGCAAGTGACAAC
GTCGACGAAGAAAGCGAGGCGCAGAAGCACAGTGCTAGTGATAGCGATGGCGAGGACAGTGCCGCTCCACGTGACTCGGACGACGTGAGATCACGAGCAG
ATTCGTCGGCCTCACACCGCGACACAAGCGCTGCTGAAAATGAAGATAAAGAACACGAGGGTCGACACGAAACGCAGTCGAGGCCGTTGCTGGTCACGAA
GCGAGACGATCGTGAAAGCGCTGCGAAAGCGGAGAGCCACGCTACCCATACACCGCAGCCGCAGCCGCAACCGCAACGTCGTGGGCCCGGACGCCCACGT
AAGGACGGGACTCCTGCTATGCCACGCGCGGAAAGGAAGACTTCGCAAGACCGTAAGCATACCCCGCCCCCTAAGGCGAGAGGAAGAGGTAGGGGCAAGG
GCCGCGGCCGCGGCAAACGTGCTACTAAACGCCTCAAGCGCGCGAAGAATGACGACGAAGACACAGAGGACGAGGCTTACGACGAAGAAGATGAAGACGA
AGACGACGATGGTTCAGACAGCGAGCTGGACTCCAACCTAGATTTCTGCGAGGTTTGCCAGCGCGCTGGCGACCTGGTGTGCTGCGATAAGTGCCCGCGC
TCCTACCACTTGAAGTGCCTGCACATGACGGAGAACGACCTGCCTGAGGGCGATTGGCAGTGCGCCGAGTGCAAGAAACCGTCAAGGTTCGACGCGTACT
CCGTGGCGGTGGCTTCAGAGCAGAGCTTGCTGGACAGGTGCCTGAAGATCGTGGAGTGCCTTAAGTCGCATCCTTTCTCGAAGCCGTTCCTCACGCCTGT
GGAGAACGTGCCACTCTACACGCGCGTGGTGAAGCAGCCGATGGATTTGTCCAAGATCGAGAACAAACTAAAGAAGGGCGCGTACATCGTGGACAGCAAC
ACTGTTGCTGCTGGCGTGAAGGAGCTGGACTCAACTCACTTCGCCAACGACATCCGGCTCATGTGGTCCAACTGCAAGCTGTTCAATGACGATGGATCGG
GTATCACGCGCGCGGCCGACATCCTATCGGCAGGTTTCGAGCGACTGTACAAAGAGTCCATCCAACCGCCGCTGTCTTCGTCGAGTGAATTGGAGCGAGC
GGAAGAAAACACTTCACAGAGGCATCGAAGCAACTGGAAGTGAGTGACCGATCAAGCAGCGCCAAGGGATTCGTATGACCATCTGTGACGTTGGTATCTA
GGAGGGTGTTCAAGCAAAATCGAGATGATAAGTGTGAGTGCGTGCCTTCAGCTATTATTACCCGGTTTGTGTGTGAGCTTTTGTCATGCTGTGCCTGCAG
TTGTGCTAAGTTAAGCCCTTCCGCTTCGGGACTTTAGGAAACGAGAGAAGGGTCCAGACTATATTCACATAAGCCGTGGACCGTGATGGAGCTCGCCTTG
GATGAGGAGGGCGCCCAGGTGACTGCCGTGACCTCGTACGATGCGAGCTTCCCGCCGGTCAACATCTTGGACGGGTGAGTCGACTTCGGACTTGAATTGA
AGGGCGTGGACTAATATCGCTTAACACTTCTCGTGTGTGTGCGTACAGAGAGCAATCGTCCAAGTGGCTGACGACGGGCAGTTTTCCGCAGGAGATCGTG
GTTCAGCTCGCCACGACGGCCTCAGTCGTCCGTGCCAAGATGTGGACGCGGAATGCCAAGGAGATGTCAGTCGAGTCCTGCAGCGGCCCGACGCCGACCA
AGTGGGAGAAGCTCTTCGATACCAGTAAGCAGGCTAGGCTCCGCTCTCTCAACTCTGGTATTGGCGGGCTAATGATCGTGTTTTGCTGGTGCTTGTTAAA
TCTTGAAGAGTTGAAGGAGTCGGACGGCGAGATGCAGATCGTGAGCGAGAACGTCAAGCCGACGGACGCGTCCTTCATCAAGTTCAAGATCCTCTCCGGC
TGGGACGACTTCGTGGCGGTGCATCGGGTCAGCGTGGAAGGCTCCACGTCACGGCGATAGACAGCTCTATATATTGATTTAATGCATCGCTTTGCACCCC
CGACTTCGGTGGCGTCTACTTCTTGCCGAAGAAGGACGTGAGCGACTTCATGCCCGTGCAATCCACGTTGGCCAGCTTGCTCTTCTTCTTGGCAGCCCCA
GCGCTGGATGGCGTCGGGCGCTTGGACGTGTTCTCTGGCGTCTGACGCCGATCGAAGCGCTTGAACGTGTCCAGCGCCCCACCAGCAGCCGCCGACTTGG
TCGTCGCAGCCTTCACCTCCACCTCCTTCTTCACCCTGCAGCAACATAACTCCACGGTCAAGAACTCACTCACTCTACCCACTCTACCCTACCCAACGTA
CCCGAACTCTTTGCACAGCAGGTCGATCCACTCGTCCGCGAGGTAGTTCCCCACTACGTCGATAGCTTCTCGGTAGTGGCGCGCCACGTCCTCCGGCGTA
ACCTTCGTAACCCCTGTACCCTTGTTCTCCTTCTTGCTCTCCTGCTTCACCCCCGGCAGATTCACCTGCTCATGGACGGCCGTGGCCTGTGCGGCTTTTG
CATTGGCCTGCGCCTCCTGCTGCGCCAGCACGGCGGCCACGCGCTCCACCTTGGCGCGTAACCACCGCGTAACCTTGCTCTCGCTGGCCTTGACGTAGAG
GTTATCCACGCTGTCCTCGCCCCCCACGGGCTGCACGTCGCACACGCGCTCGATGGCCTCCTGCGTGAGCGTCTGCAGCTGCAGCAGCCACGTGTTGCCG
TCCCTAGCCAGCAGGTCATAGACCGACTGGAACCTCGCGCGCTGCGTCCAGGCGGCGTCCAGCAGCACGAACAGCGCGTCCAGCGGCGAGAAGAGCGTCA
GCGCGCCGTCCTGCAGCACGAAGTTGCCCACGAACCAGCTGCGCGCGCCCTCGGGCGGCTGCACGCGCTGCAGCTCCAGCAGCCGCCGCTTGTGCCGGTC
CAGCGCCACTTGCCGCGTGCGCACGGCGGCGTCCGCGCCCGCGCGCGAGGTCCAGAGCGCGACGGACAGCAGCGGCGCGTCCGTGGCGTCCGCGTGGAAG
CGGCCGAGGTTGGCGGAGGCCGGCAGCTCCGTCGGCACGAGCGCCAGCAGCTTGCGGCCCATGAGGTTACGGTCGCTGCTCGAAGATCACCACGCGCGAG
TGTAACTTTTGAGGTTTCCCGCCAAAATTTGAGTTACGCTTGGGTACACTTGGGGTACGTTGGGTACACTTTTTAGCGCCAAATTGCCTGTTGCTCGCAG
TAGCGAAAAAGCTGCAGCTGGCGTGAGTGAGTGACTGAGGCGGCCATGGGGAAGAAAGGTGCGCCTGTGGAGGGGTACGCTGCGCGTGGATGCAAGCGCT
AACGTGTTGTTGATTGGCTCGCGCAGCTGCGCCCAAGATGCAGCGCTCCATCATGTGCGTAACCGTGCTGGAATGCGAGCAACTAGGAGGGTAACCCAAA
GTGTAACCTTTATTTATATGGACCGTACTAGGTCGTTCTTCGGCGCTGGGGCGTCCACGCCGCCGGCCAAGAAGCGGAAACCTGCGGACGATGACGCGGG
CGACGCCGTCGAGTCGCCGGCGAAGCCCGTAAAGAAACCCAAGAAGAAGGAGAAGAAGGAAGAGAAGAAGGAAGAGAAGAAGGAGAAGATCATTGAAGAA
GAGGAGGAAGAGGAGAAGGAGAAGCAGGTGGAGGAGGAGCCAGAGGACATTGAGATGCAGGAGGCAGAAGAAGAAGAAGAGGAGGAGGTTGTCAAGAGCA
AGACGAAACGTACGTGGGTCTCTTCTTGTCGCTGAAGATTGAGAGAGCTGAAGGGCTAACTGATCTTTTATCTTGTTGCCAGCTGGTCGTCGTCGTCTGC
GTCAGCGGGTTGTGGAGGAGGAGGACGAGGACAGCGACCTGGATCTGCCCATGTCGACGGAGAAGAAGGCGTCCAAGGAGAAGCAGGAGGAGGTGATCGA
CATGACGTCGCCGACGTCGACTCCAGAGAAAAGTAAGAAGAAGGAAACGGACAAAAAAGGCGAGACGCCGGTGAAGTCCAAGAGCCCCAAAAAGGAGGAG
AAGGAGGAGGAGGACGACGAAGAGGTCGAGATTAAGGAAGTCGAGGAGATTGAAGATGAAGATGAAGAAGTGGAGGAGGTTGAAGAGGTCAAGCCGAAAA
AGGAGAAGGTTAAAGAGGTCAAGCCGAAAAAGGAGAAGGCTGAGGAGGTCAAGCCGAAGAAGGAGGCGAAGAAAGAGACGGCCACGAAAAACAGCTTCTT
CACTCCCGTGTCCGGCAGCAACAAGAGCAAGGCGAAGATGACCTCCGCCGACGACAAGAAAGAGAAGGAGGTCAAGACGGAGTCGGAGCCAAAGGCCAAG
ACCGAGACTACCGAAGCTCAAGACGACGACAGCGACGAGCCCCGGGAGACCCCTTACTTCGCCCTGGCGCACTTGTTCGCCAAGATTGAAGAAGTCACGG
GCCGTCTCGTCATCCAGGACCTGCTCACGGCCTTCTTTCGCGACGTCATCCGTCGCTCTCCTGACGATCTGCTGGCCTGCATCTACCTCTGCGTGTGCGT
CGACCTGGCGCCGCCTTTCGAGAACCTCAAGATCGGCATTGGTGACGCAATCCTGATGAAGGCCATCGGCGAGGCCACCGGCGCCAATCTCAAGTTCATC
AAGGAGATGTATCACAAAGAGGGCGACCTCGGTAAGGTTGCGCAGAACGCGCGGTCCAAGCAGAAGACGCTGTCGTTTGCATCGATAAAGCCCGCAGCGT
CCAAGGGCAGCGGCCTCACCGTTCAGCACGTGTACAACCAGTTCGTCAAGATCGCCAAGATGACGGGCAACAACTCGCAGCAGCAGAAGTGCTCGATCAT
CAAGGGATTGCTGGTCAAGTGCGAGAAGGAGAAGAAGTCTCAAGCCAGCGGCGCGCAGTCCGCCGAAGGAGCCAAGTACATCATCCGTGGACTCCAGGGT
AAGCTTCGTATCGGTCTCGCAGAGAAGTCGATCCTCATGGGTTTGACGTACGCGTTCATGACGGACAAGACGTACAAGGACAAGGACAAGCAGCAGGAGG
CGCTTGCGTATGTCAAGAAGGCGTTCGCGGAGTGCCCCAGCTACAACGCGCTGGTCGCTGCGTTCTACGAAGTGCAGAAGGAGGTGCCTAACGCTCCGTT
CCTCCGCGTGAAGGACTTCGCCAAGGTGGCCGAGAAGTGCGTGTTGACGCCTGGTACTCCTGTGTCGCCGATGCTTGCGCGGCCGACCAAGGCGTACGCT
ATGGTGTTCGACCGCTTCGAAGGCAAGCCGTTCACGTGCGAGTACAAGTATGACGGCGAGCGCGCCCAGATCCACATCCTCCCGAACGGAGAAATCGCCA
TTTTCTCGCGTAACTTCGAGAACTCCACGGAGCGTTTCCCTGACGTCAAGCTGGCCATCTCGGAAGCAACCAAGAAGAAGGGCATTGTCAAGAGCTGCAT
CGTCGACGCTGAAGTGGTGGCTGTGGACCGCGCCACCAACAAGCGCCTGCCGTTCCAGATCCTGAGCACGCGCTCGCGAAAGGTGCGTCATCCAGTGTTA
GTGACGACGCTTGTATTGTGTTCTAACTAACTCTTACTGTTGTGCTTGTAGAACGTGAAAGTGGAAGACATCAAGGTGCCGGTGTGTATCTACGCGTTCG
ACTTGCTGTTCCTGAACGGTGAGTCGTTCCTCGCCACTCCGCTGGCCAAGCGCCGTGAAAAGCTGCGGGATATGTTCGAAGTGAAGCCGGGCAACTTCGA
GTTCGCTACCTCATTAGATGTGGAGGACTGCGTGGACGTGAAGAACAATCCTGAGGCGATAGACGAGGCCGTGGACAAGGTGCGCACGTTCCTGGAGGAA
GCTGTGCGCGAGAACTGTGAGGGTTTGATGGTCAAGACCCTCGAGAAGGAGGCGACGTATGAGCCTGCGAACCGTTCTCACAAGTGGCTGAAGCTGAAGA
AGGATTACCTCGACGGCATTGGCGACTCCGCCGACTTGGTTCCGATCGGTGCGTTCCACGGTCGCGGCAAGCGTACGGGTGTCTACGGCGCGTACTTGCT
TGCATGCTACGACCCAGACACGGAGATGTACCAGCCCATTACGAAGCTGGGCACTGGGCTGTCGGATGAAGTGCTCAAGCAGTTCCACGACCAGCTCAAG
GAAAAGGTGGTGGACAAGCGACCGAGTGACTATGCCATTGGAGAAGGAATCAAGCCTGACGTTTGGTTCGAGGCCAGTTGCGTGTGGGAAATCCTAGGTG
CCGACCTGTCGATTTCGCCCAAGTACACGGCAGCCATCGGGCTTGTGGCGGAGGACAAGGGCATCTCGCTGCGCTTCCCTCGCTTCATCCGCATCCGCGA
CGACAAGGATACCACGCAGGCGACCAACTCTTCTCAGGTACGGGTGATGGATGGATTATTTATCGTTTGTCATTGCGTATACTAAGTTCTTGCTGTGTCT
GTCATGTTAGATTGCCGACTTGTACCGAGCCCAGGGCCTCACGACTGTAACCAACGGTGATGAAGAGGAGGACGATATGCTTATCTAGATGCAACTGGAA
CTAACATTGCGCTCCCCTAAAACTAAAGACAGCTATCAGGCGTAGCCTTCGTGGCTAGCTTTCTCCTGTCTCGTTGTTGGCTTTTTCTTGTTGTTTTTTG
CGCAGGAATTGCAAAGGCCCCTGAAACGATTTCATGAAACGCTTCAAGCGGCGAGGGAGCTTCATGGGCGAGCGCAGCACTCGGCAAGTGACTAATTATA
AAGGGGATGGGTGATCGGACCTTCGGACGAGATGGACGAGCCCCCGCGCCGCGCAGAACGACGAACTTCGACGGGCATCGTCGCCACGACCAACAACGTC
TTCTGGTGGAGCTGGAGCTGGATGACTCGCTGTACCAAGGCACACTGCAAGCGGGTATTGAGCAGCACGCACCGATGTACCCTGTTCCAAGCAGAAGGTC
AACGCACGCTGGGGATAGTCGACATCTCCAGCACAGCGACTACATAGTCGAACCAAGACAGCGCCTGTCGTCAAGAAACCCTCGTGATTCAACAGCCAAG
CCACTCACGGAGCGCCAGATGCAGCAGCTTAATGCCAAGCGACTCTCAAGTCCGTACAAGTTGAAGCAGCAGGTGCTCGACACGCGAAACGACTCACCAC
CTCGTCGTTATCAGCAGGAGGGCTCCGGTACACGGCGAGCAATCCGGTCACCCACCATGCAGCAATCACCGGCGCATCTCGTGATGGAGTCAATCCGGCA
GAACATGCATCTACGCGACCAAGTGCTGGCCCACTTACAGCAGGAGCTCATGGGCGTGTTGCCGCTGCATCGGGCGTCTCATGTGGAGAAGAATGTGCCG
CAACGGGTGGTGAAGCTTCTCAACAGGATGCGCAGTTTGTCCCTCGCGGTTATCGAAGCAGTGGTGTACTTGAGCGGTGAGCTTGGAGATTCTAATGTCG
TGGGTCAGAGTGTCGAGCATGAAGTCTTGGAGCAGGATTTCTTCGGGTATTTGTTGACAATGGCATCCGATTCAGATTTCCTGGCTTGCTCGCCACAACT
CCAGCGATTCTTCGAGGACTTCGAGGTGAATTTGACGCGCAACCCGTTCGTAGACGGACTATCGCTGGACTCGTCGGAGGTGCTGCTGTGTTCCTGTCAT
CAAAGTACCGACTCTGGCGTTTTATTCTGCTCTGCTAGTTCGTCCCCATCGTCTCTCTTGCGGCTGTTGAAGCAGAAGCTGGAGACGTTTGCGCTCCAGA
CTCAGGGATATCTCCCAGGATGGCAGATTCTACCAGCTGAACGCGTGGCAGCAGCGCTGTTGCACTTGATGGACCTTGAAACGCGCTTCCATGCTGTTCG
GATGATCCCGAGATATCTGCAATCGCAAATCGACAGCAAGAGGTATTTGCATCAGCAACGCGGACCAGATTGCGTTACGTCCTCGCACGGGTATGGTACG
TTTGAAGACGAAAGGATACAACGGCTGGATCGTGAGGTCTCTCAAGCATCTCTATCAAGTGATCATGGCCCACGTCGTGGATCATCCGTTGTTGAAGCTT
GGGCTGGCTCGCCAATACCAAAACCTTCTGCAGTACCCGCAGCTTTGAAGCAGAATACACCGGACCAGCAACCGCCACCGGTTAAGACCTCAAGCAATAC
CGCTCGAAGTTTGTCAAAGAAGGAAGAAGACACCAGACGACCTTCTTCGGCATGGATACCAGTGCCAACCTCGCCTGAGCCAGAGTCTACTCGATCAGTA
ACTAGCACTTCATCGTCTGCAAGAAAGGCACCTGCCGATACTGATTCTGCTGGGGATGGAGTCACGATTACTCGGCTTGTTTTACCACCGCCCGTGCTCG
ATGTATCAGCAGCAGCGAAATCGTCCACCAGAAGCAACGAATCCGAACGAGCTGCTTCAAAAAGGAGGAGCAGCAAGGCTACCGACAAACCCGACAATCG
TAAGACACTCGTCGAGTCTGGAACTCAGATGAGCGAGCGCAGCACACCATCGATGGTTGTTACGCCAAAGGAGGTACCAGCACCAGAGCAATCAGCAAGA
ACAAGGGCTACGCGAGACGAATCCATGCAGGTTTACCAGGATGAATCAGCGAATCTTGTTAGCGAAAGGAGGCCGTCCGTTCGAATCGTGAGAGGAGACG
ACCGGAAGCCTGAAGCATGTGAAGTCCATCCTGCTCCGAAGTCTGTGGAGGACGAACTATCGGAATCTGTGGTATCGTTGGAGCTTGATGCCTCTGTCAG
CCCTACTGATCTAGGCCAATGGAGTAATGCAGAGCTGGATTCCTCGCGTGATATAACTGATGAACCGCGTGATGTGGTCGATGTTGTGGCAACACCGACC
GCTGACGATGATCGTGAATTTCGTGAACTGGAAGCTAATGCTGAGCTTGCAGCGGATCTTGATGATGGATACGACTGTAATTTCGAGTACTCGTCCGACG
AGGCATTGTCCAGCATTGCGATGGCCTTGCAACTGTTGCCTAACTTCACGCTGTCGAACACGGAGTCAACGCTGGATGATGATGAAGTGACGAAACCTGA
GGAGGCGATACCACCGAATGACTATGAACGTGTGGAGTCAAGCAGAGCGGAGGCACACGAGGCTGAGTTTACTGCAAGTATTGCTCA