Description :
From Genome Similarity Track
Location :
Scaffold_130:9492- 10659
Transcript NameFunction/comments
Phyta_totarag4210hypothetical protein PHYSODRAFT_491744

Sequence
1167 bases(100 bases per row)
ATGGCAGGGTTTCGATGGATGTAAGGCAAATTGCTTGGCAGGGTCTTGATTTGCATCCGAACACCCTGTTCTTCGTCAATAGTCACGATGCGCGGTGCAG
GTGGAGTGCTGCCTGCCTCGGATGGGGGTCCACAGGTGAGAAGTTTGGCTTCGACGCGCTTCGTGATCGCTGCTACTGACCGGACTGAATGCACGGACCG
AATCGACTTGCACTCGGAAATCAGGCTGCTGGCCACACTCatggcatcgtcgtcgtctttggCCTCTACGCGGTCCCATCCAAGCCGAGATAGGTCGTTC
CCGTTGAGAGCACCACCTCCATTGACCAAGTCCtcaagccgctgctgttcacgCTCGTAGCGCTTTTCCTCGGCCTCTTCGTAGTCCACAATAGACTGCA
CCTGTGCTAACTGCTGCTCTACTTGAGCAACACGTgccttgatctccacgtcgtccatgaACTGATCGATGTCCAAGTTATTTGCGAAGTCGATGAGGTC
GTTggcttcagcatcttccagACTGTCGAGCTTCTCTTCGGCCGTGGCCTTCGTAAGTGCCCACATGGGGCGATTCaactgtttcttcttcttcttctcc
acatcTAGGCCttcctcgctgtcgttgttgctgctgcgcactGCCTCACGCAGCTTGGCTTCTCGCTGCGAGAATCGTTCTCGGCGTTTTTGGGcggcat
cttcgtcttccgcaAGTGTTTCCTGCAGTCGAGCACGCTCCTTCTGCAAGtcgtgcagccacttcaTGTGCTTCGACAGAGCGGTGCTCTTCTTGTCACG
ACGGATTCCATGCTGCATATCAGCCAGCACAAGTACCAATAGCAGCGACAACCGTCAGACATCATGTCAAAGTGCACAAACGCAAGACACAGCCAAGCTC
ACCGCAGGCTCGCTGAGAATCGGCACGTTCAATCCGAGAGGCTCTCCGGGGTTACCCGCCAGGAATGCCGCCTTGCTGTTATCGACCGCGTTGTTGTTCG
TCTTGGTACCGTATCGGTTCTCCTTCGCCAGCGCTGCACAAGCAACTCACAAGGTCAGACAAACACTCGACCAAGACTCGTCAATGCAGCTGCTTACTGC
TGGAAACCCCGTTGAATGGCCGATTGCACAGCATGACGCCCTTGTAGTTGCCGATGCTCACGGCCGC