Description :
From Genome Similarity Track
Location :
Scaffold_47:94918- 97759
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15328phospholipid-transporting ATPase

Sequence
2841 bases(100 bases per row)
AGTGGCGCACCAGGAGCAGCGACAGCAGCCCCAGGCCCAGAGGAGACACTGCGAGAGGTCTATTTCAACTATGCACCTGGCAACGCTGTGTTCGACAAAT
GCTCGAACGTCGTGGTGACGTCCAAGTACAACTTGGCCACTTTTTTCCCTAAATTTCTCAAGGAAAGCTTCACTAAGGTGGCCAATTTCTTCTTCCTCAT
GGTCTGCGTGCTGCAGAGTATCCCTAGTATCAGTAACACGTACGGCTACCCGACCAACGCGCCGGTCTTGTTCTTCGTCATCTCGATCGACGCCGTGTTC
GCCGTCATGGAGGATTTACGACGCCACAAATCGGATAATGAGGCCAACTCGGCCATATGCCACGTAATCCAGGACGGTCAGGTCGTGGACAGGAAGTGGG
CGGACATTAAAGTCGGAGATTTCCTACAGATCCGCAACCGGGAAGTCATCCCGGCCGACGTGCTGGTGCTCGCCGTGTCAGAGCCCGTGGGCGAGCCGCC
CAGCGGCATCTGCTACGTCGAGACCAAGAGTCTGGACGGCGAGACGAACCTCAAGCTGCGCCAGGCGGTGGCCGCGACCATGAGCTCGCTCGCGAACGCC
GCCGAGCTGGCGCTGCTGCGCGGCGTCGTTAAGTGCGAACAGCCCAATCCGCACATCAATAAGTTCGCAGGCAAAGTGGAGGTCACAGTGGGCGACGGTT
GCGGCGTGGAGGTGATGCCGTTATCAGTTAAGAACGTGCTGTTACGAGGTTGCAATCTGCGCAATACCGACTGGGTTTTTGGACTAGTGTTGAATACCGG
TAACGATACCAAGATCATGCAGAGTGCCAGTGCCGCTCCGTCCAAATGGAGCGACTTGATGCTGAATATCAACCGGATGATCGTCATTCTGTGTCTGGGG
CTGTTTGTCGCCTGCGCCATGGCTGCAACCTGCTACATTACGTGGCAGTACGACATTGTACGCAACGCGTGGTACATTCAACTGACGGAAACCGAGAGGA
ACCGCACGCGTCTCGTGGCGTTTATCCAGATGTTGTTCTACTATTTCTTGCTGTTGTATCAGGTGATCCCCATCTCGCTCTATGTGTCCATGACAAGTGT
CAAATTCTTACAGTCGCGCTTCATGTCGTGGGACCTCGAAATGTACCATGCTGAAACGGACACACCTGCCATCGTCCGGACGATGGAGCTGAACGAAGAA
CTGGGCCAGATCTCGTACGTTTTCAGTGACAAAACTGGTACACTTACGTGCAACATCATGGAGTTCCGTAAGTGTTCCATAAACGGTATTTCGTACGGCT
CCGGTATCACGGAAATCGGTCGTGCCGCACTGGTTCGAGCTGGTAAACCGATCCCGCCAGAGCCTAAACTGGACCCGAGTATCAAGAAGATTCCGTTCGT
GAATTTCGTGGATAAATCTCTATTTGACAGTATGAAAGGTAGTGCAGGAGAAGAGCAGAAGGAGAAGATCATGCAGTTTTTCGAACATCTCGCAGTGTGC
CACACTGTGATCCCAGAGAAGCTCGAATCCGGCGAAGTTCGACTATCCGCGTCGTCTCCTGATGAACAGGCTCTTGTGGCAGGTGCAGCCTTTGCAGGGT
TCAAGTTTGAGAGTCGTAGTGTTGGTACAGCGATGGTGGAGGTTCTGGGACAACGTGTGACCTACGAAGTGCTGGACGTGCTCGAATTCAACAGTACGCG
TAAGCGTATGTCCGTCGTGGTGCGTAAACCCAGCGGAGAGTTACTTCTGTACACGAAAGGAGCCGATATGATGATCTATCAGCGTTTAAAAGACGACCCG
GCGATGCTCAAACTCAAAAACATCACACGAGATCACATGGAAAAATACGCAGACGATGGATTACGAACACTGGCGCTTGCAGTCAAGAAGCTGGACGAGC
GTTGGTTCCAGCAGTGGAAGATGCGGTTCGACGATGTACAGGGTAACGTGGCTGAGATTGATCGACGAAAAGACGGTAAACCGAACGCTATCGACGACCT
GATGGAGGAGATTGAAGAAGGTCTGGAGCTTATTGGGGCCACAGCTATCGAAGACAAACTTCAGGACGGAGTACCGCAGTGTCTGGCTAACTTGACGCGG
GCGGGTATTAAAGTGTGGATGCTTACAGGCGACAAGGAAGAAACGGCTATCAACATCTCGTACGCCTGTTCTCTGCTTGACAACTCGATCCAACAGGTCA
TAGTGAACGCCACTACATGTCCAGACGAGGCAGCGATCCGTGCAAAACTGAATGCTGCAGCCAGAGAGTTTTTAGACAGTGCCAAGGGGATGGCAGGTGG
CAGTGAGAAGGAGATCTCGTTGATTATCGACGGCGAAGCACTGGAAATGGCTCTGCGACCAGGAACGGCGCCACACTTGTTGTCCTTTGCGAAGCTGTGT
CGCGCCGTGATCTGTAACCGAGTGTCTCCTGCTCAGAAGGCAGAGATGGTCAAGCTGGTCAGAGATAACATCACAACAGTACGGACACTAGCGATTGGCG
ATGGAGCTAACGATGTAGCCATGATTCAAGCTGCTCACGTGGGTGTGGGTATCTCAGGACAGGAAGGAATGCAGGCTGTCAACTCTAGTGACTACGCTAT
CGCCCAGTTCCGCTTCCTGGAGCGATTACTATTGGTTCACGGACGTTGGAACTACATTCGTATCTCGAAACTGGTACTCTACATGTTCTACAAGAACATC
ACGCTAGTACTGGCGCAATACTGGTACGGCTATCTGTCCGGCGCTTCTGGCTCGAAAATGTACTGGGAGATCGGCGTCCAGCTGTACAACATCGCATTCA
CAGGTCTCCCTATCGTGGTCGTGGGTGTTCTGGACAAGGAC