Description :
From Genome Similarity Track
Location :
Scaffold_84:949- 2758
Transcript NameFunction/comments
Phyra_83175PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1809 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCTTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTAATCTCGTGCCGGGAACAAAGTATTGCGTCACGCGGCAGTGGCCACTGTCGCGTGAGCAAG
TCAAGGCAATTGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCAAAGTCGCGCCTACGTTCTGTGTCAAGAAGCCACAGGGCGGG
TGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCAATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGA
GTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCCGGCGGCAT
GCTCTGGGAGTGGTTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCA
CCGAGCTATTTCGATGATGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCA
TGCGAAAGCACAAGCTCTACTCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCC
TGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAGTTAC
GTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTTAGCAGGCCTTCGAAGCAG
TCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGC
ACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGCA
CTCCTTGCCATGAAGTATGCACTCGCAACGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGA
CTAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGT
GTCTGACGCGCTTTCGCGTCGACCAGATTATGCGGCGCACGAGGCCGACGCCAACGCAGTCGGTGTCGTCAGGACGACTACACCCTCGTTGTCCTTGTTG
GATGACGTGAAGGCCGCATACGCGCATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCTACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAAC
ACCTCCGTGCTCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCACTGTCGTGCCGGATGATCA
TGAGTTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGAGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTAT
TGGAGTCAC