Description :
From Genome Similarity Track
Location :
Scaffold_609:949- 2015
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_609-fgenesh-gene-0.3Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_609-snap-gene-0.8DCN1

Sequence
1066 bases(100 bases per row)
CCGCATCGTATTGGGCACGCCGCCGTAGACCTGCATCTCGCCGTGGTCGCTCTCAAACACGTCGTGCTCCTCTTCGTCGTCCTCTTCCGCCTCGCTGTCT
TCGTCGCTCGCCATCGATGCCGGCCGCTCACGTCCGTGCTCGTCCAGCTCGACGAACCGACTCGAGCGTTGGTGGTTCGACGCGCCGCCGCCTCGACCTC
GAGAGAGCGTGAGCCCCTCCAGCTGCTCCGCGAGCGTCCGCTGGCGCTTGCGGGACGACACGCTGCGCCGCAGCGACGACTGAAATGTCGGGGCGTGGGT
GGGAGTGAACGTAGCGTGGTGGTGCTGCCCGCGCTGGAAGTAGTTATACGACCGCTGCTGCATGGTGTGCGCATCCAGCGCCTCGATCTCGATGGCCTCA
TCGCGCCGCCGACGGACGCCGCGGTGTGGCGCGGCAGCGCGGACGAACGGCGGCGAAGAAGGCGCCGGCGCGCTGTCCATCATGCTTCCTTCGACCGAGA
GAGCTCTGAATGATGGAACAAGGATGTGCGTCGCCTGTCGTACCGCGTCTCCTCCGAATAGAAGGGCGACAATTGTCCAACAATGCGAACCTATCTCTGC
GAACTTTGCTCCATTTCCTTGCTGTTGCGGTTGCGGAGAGCGAGCCAACCAAGGTGGCGAGCACGTTGAAGGCTCGAGGAAGACGCTGTGTTGGACTGGA
GGCGAAGGCACAGCGGCGGCCATGGACCTCACACAGCTCCGCGTGAAGGAGCTGAACGAGCTGTGCATGAAATTCGGTGCGTTGCTGGCGGAGTTTCTCT
CGTCTTGAATGTATCGTGTACTGCCACAACAGTGATGTAATCGGATCGGTGGCAACACTACGACATTCGTTCCTCCCTTGGATATGAAGTGGATGTATGT
TGATGAATACTGCGTCGATTGTCATTCCTGCAGGCGTTCGCAAGGGCGGGAGGAAAGCGGACATTGTCGAGCGGATCAAGGCGAGCTCCGCCTATCAGCG
CGAACAGGCGGCAACACCCGCCAAGCACGGCAAGCACCACTATCGCAATGGACACCAGGCGGGTGG