Description :
From Genome Similarity Track
Location :
contig_11:948837- 950757
Transcript NameFunction/comments
g3246.t1hypothetical protein

Sequence
1920 bases(100 bases per row)
TGCAATACGGACGGGGTAACCTGCGCGGTTGACACGCACAGCTTCAAGGACACCGCCTGCCTTGAGCTGGTCGCACACACGCTTGGGCATCAAAAGGTTG
GCTTTTGCTTTGTCGTTGGGCTTGAGGCAGCGTACGTAGTGGCAGTCAGTCACATTGATCGTTTCCAGAAGTGTCTTCAGTTGAGTACGGAACTGCAAGC
CTAAGCTCACACGTGTGGCAACACTGGAGGCTCGGCCCTTCGGCTTCTTGGACGGCACTTTCTTCTCAGATGAAACCTGCAGCAATCCCCGAACGAATGG
CTTCGACGATCGCTTGATGATCGCAGTGATCTCCGGGTACAGAATGTCCTTGTTCTTTTCACAGAATCCAAAAGTGTCGTACGAGACGGCGCCGGCGTAG
TGGTGTACAACAAAGAGGTGGTTGGCAATCTCCGTCTTGGTTGCGCTAAAGTGAGGGTTGAGTTCGTGCTGTCGGTACAGCTTTCGCGCAAAGTTCTGAT
CGCTACCCTGGGGAACGATGCACTCTTCGTCAAGTGCCGGGAGGATGCCGAACGGCTTACCCTGAATCAGGTCAATGCACGGGCCATTGTCTGGGAAGTT
GACGAAGCTCCACTGAATCTCTTCCTTCTCGTACGTCTCCTGTTCCATACGCAAAACAGTGAGGTTGAAGTGCTGCTGTAGCGTTTCGTTAGCGTAGTTG
ATGCACAGTTGCTCGAACGAGTTGTGCTCCAGGTCCTCGAAACCAAAAATATCGAGCAGGCCAATGAACGGGACATCACGGTCCTCGTACTCCACGATCT
CATTGATGCGGCTCACAAGCCAATCGAAAAGCTTTCCGTACAAAAACCGAGCAAGCGCGTCACGGGCGTTCTCGGCAGCGTCCGGCAGCAAACCAATGGA
GTAGTGCTCGTCCTTTGTCTGAATGTTGCGGTTGCAGATAGCCTGCTCGAGGCCTTGCTTGTCAACCTCCAAGTAGTCGAGCACTACTTTCATCGAGTCT
TCACACATGCTTGAGATCTCTGATCCCTCCGTACCTGATGCCTGGTGGGTCTCCTCAAACTCTAGGTTACCAATGTGAAGCAGAGATGCGATTGTGGAGA
AGATGCTCTCTCTGTCATCCTCGTCGAAGCCCATCGTCTCCATAGCGTTTTTTAGGACCCCAAATTGCTCCGCATCATTCACACCATCTTTACGCTTGAC
ACACGTGCTCTGGTTGAGGTAGTGGAACTTGGTCGGCGCCTTCAGGGCCCACCGTTTCTTCTCTTCTGGAGAGGCACCAGCAATGATCTCGTAGAAAATG
TGGTAGTTGCGCTCCGACTCGGCCTGGTACGCGAGACGCACCTTCTCCAGCAAGTACGTCTGAATGGACGCACCAATGAGGTTTCCCTGCGGCGAGAACT
CCATCTTGATGAACTTTCCGAATCGACTGCTATTGTCGTTGCGAATGGTACGCGCGTTACCGAAAGACTCGAGGATTGGGTTTGACGACAGCACTTGCTT
CATCACGTTGCTGTCGGCGGAGGCGTTCTTGTGCTGCGAGATGGTGGCCAAATAGTTCATGACGAACTTGGTCGTTTCGGTCTTGCCGGCGCCGCTCTCA
CCGCTGACCAGGATGGACTGGTTGGCGGCACTTCCATCAGAGCTGTGTCCAATCGGGTTCATGAGCGAGCGGTATGCCTTGTCGGCGATGCTGAAGACGT
GAGGGGGCATGTCGGCCACCTCATGGCCCAACGCCCGTTTGTCTCCATTGCGTATGTACTTGCGCGTGATCTTCTCCGTGTATATACCCAGGTTCTGGAA
GGGGTTGATGGCCAGCAAGATCTCGCCCGTGAGCGTGTAGATCTCGTTGATCTTGAAGCGCTCGTTCAGTGTGTGGCAGATGCCTGGCTCGTGCAGGTGT
GGCAGCTGAATCAGGTCCTC