Description :
From Genome Similarity Track
Location :
contig_11:948831- 950751
Transcript NameFunction/comments
g3411.t1hypothetical protein

Sequence
1920 bases(100 bases per row)
TGCAATACGGACGGGGTAACCTGCGCGGTTGACACGCACAGCTTCAAGGACACCGCCTGCCTTGAGCTGGTCGCACACACGCTTGGGCATCAAAAGGTTG
GCTTTTGCTTTGTCGTTGGGCTTGAGGCAGCGTACGTAGTGGCAGTCAGTCACATTGATCGTTTCCAGAAGTGTCTTCAGTTGAGTACGGAACTGCAAGC
CTAAGCTCACACGTGTGGCAACACTGGAGGCTCGGCCCTTCGGCTTCTTGGACGGCACTTTCTTCTCAGATGAAACCTGCAGCAATCCCCGAACGAATGG
CTTCGACGATCGCTTGATGATCGCAGTGATCTCCGGGTACAGAATGTCCTTGTTCTTTTCACAGAATCCAAAAGTGTCGTACGAGACGGCGCCGGCGTAG
TGGTGCACAACAAAGAGGTGGTTGGCAATCTCCGTCTTGGTTGCGCTAAAGTGAGGGTTGAGTTCGTGCTGTCGGTACAGCTTTCGCGCAAAGTTCTGAT
CGCTACCCTGGGGAACGATGCACTCTTCGTCAAGTGCCGGAAGGATGCCGAACGGCTTACCCTGAATCAGGTCAATGCACGGGCCATTGTCTGGGAAGTT
GACGAAGCTCCACTGAATCTCTTCCTTCTCGTACGTCTCCTGTTCCATACGCAAAACAGTGAGGTTGAAGTGCTGCTGTAGCGTTTCGTTAGCGTAGTTG
ATGCACAGTTGCTCGAACGAGTTGTGCTCCAGGTCCTCGAAACCAAAAATATCGAGCAGGCCAATGAACGGGACATCACGGTCCTCGTACTCCACGATCT
CATTGATGCGGCTCACAAGCCAATCGAAAAGCTTTCCGTACAAAAACCGAGCAAGCGCGTCACGGGCGTTCTCGGCAGCGTCCGGCAGCAAACCAATGGA
GTAGTGCTCGTCCTTTGTCTGAATGTTGCGGTTGCAGATAGCCTGCTCGAGGCCTTGCTTGTCAACCTCCAAGTAGTCGAGCACTACTTTCATCGAGTCT
TCACACATGCTTGAGATCTCTGATCCCTCCGTACCTGATGCCTGGTGGGTCTCCTCAAACTCTAGGTTACCAATGTGAAGCAGAGATGCGATTGTGGAGA
AGATGCTCTCTCTGTCATCCTCGTCGAAGCCCATCGTCTCCATAGCGTTTTTTAGGACCCCAAATTGCTCCGCATCATTCACACCATCTTTACGCTTGAC
ACACGTGCTCTGGTTGAGGTAGTGGAACTTGGTCGGCGCCTTCAGGGCCCACCGTTTCTTCTCTTCTGGAGAGGCACCAGCAATGATCTCGTAGAAAATG
TGGTAGTTGCGCTCCGACTCGGCCTGGTACGCGAGACGCACCTTCTCCAGCAAGTACGTCTGAATGGACGCACCAATGAGGTTTCCCTGCGGCGAGAACT
CCATCTTGATGAACTTTCCGAATCGACTGCTATTGTCGTTGCGAATGGTACGCGCGTTACCGAAAGACTCGAGGATTGGGTTTGACGACAGCACTTGCTT
CATCACGTTGCTGTCGGCGGAGGCGTTCTTGTGCTGCGAGATGGTGGCCAAATAGTTCATGACGAACTTGGTCGTTTCGGTCTTGCCGGCGCCGCTCTCA
CCGCTGACCAGGATGGACTGGTTGGCGGCGCTTCCATCAGAGCTGTGTCCAATCGGGTTCATGAGCGAGCGGTATGCCTTGTCGGCGATGCTGAAGACGT
GAGGGGGCATGTCGGCCACCTCATGGCCCAACGCCCGTTTGTCTCCATTGCGTATGTACTTGCGCGTGATCTTCTCCGTGTATATACCCAGGTTCTGGAA
GGGGTTGATGGCCAGCAAGATCTCGCCCGTGAGCGTGTAGATCTCGTTGATCTTGAAGCGCTCGTTCAGTGTGTGGCAGATGCCTGGCTCGTGCAGGTGT
GGCAGCTGAATCAGGTCCTC