Description :
From Genome Similarity Track
Location :
Scaffold_582:9487- 12164
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_582-snap-gene-0.14LIM zinc finger domain containing protein
Pytir_DAOMBR486maker-pir_contig_582-snap-gene-0.9TRNA pseudouridine synthase

Sequence
2677 bases(100 bases per row)
TCCTTGGCTTCCTTGGCTTTGCGCGCTTCCTCCGCCTCCTTGGCAGCCTGCTCTGCTCGCGCTCTCTCCTCACGCTCCTCCTGCTCCTTCTTCGCGCGGG
CAGCGGCTTCGGCAGCTTCGCGCTCTTTCTTCGCCAGCAACGCACGTGCAGCTGCCTCGGCAGCCTCTTTCTCGGCCTTGGCCTTCGCAGCAGCACGCTC
CGCCGCCTCGCGGGCTTCGCGTTCCTCGCGCTCTTTTTTCTCTGTTCGTTTGGAAGCACAAGTCGCCAGTTATATCAGCTTGAGCTGTGTTTGCTACAAT
AAATAGGACGTAGATGAAATTACCGAGCTCACCTTGCGCTTCAACACACGTCTTGCACACGAGCTTCTCGTCCTCAAACTTGGAGCCTATTCGTATTAGC
AAACATACAAAATCAGAACGACGGTGAATATAACGCAACCCACTACTATGTACTTGCACCAATCTCATGCTCAAAATTCACACACGGACCTTCTTCCGCC
TGCTGGTTGCACAGCGAGCAAACCATACAGAGGCGGTGGAACGATCCCTCGCCAGCCTTGTACACGCGTCCGAGGATTTCCTACAAAAATTGCGTTGATT
ACGAAAAGCAGGATAAGCACAACAGCTCATTGTTCAAGTTCGATAGGCGGAGTTTCAGAGCATTTCGAACCTTGTCGCACACGCGGCAGTGCTTTACGTC
CTTGGCGCACTCGGCATGAAACGCCTTCTTCTTGATGAGCGTAAAGTCCTCGTCCTCCTCAATGGATTCGCGGCAGCCAGGGCACAGCAGACACTGACAC
AACAATCGACAAATTAACACTGTATGAGCCGCAGGCACACAACAAACAGAGCAAACATAGACACCATCATCATCACTCACAATTTCGTGGAAAATCTCGC
TCTTCGCGGTCTTCGTCCGCCCCAAAATGGTTTCTCGGCACGCGTAGCACTTGCGCAGCTTGCGCACCGTGGGCTTGCGGTCCATGTCGCTAGCCTTCGC
GTCCACGGAGGCCGGTCCCTTGGGCGCCTGCGGGTTGGACGCGTCNNNNNNNNNNNNNNNNNNCCTCGAGGCGCAGCGACGAGTTGTAGTCCACGCCCGA
GTCGTCCGAGCCGCGTGAGCTGCCGAGCGACGAGCGTGATGACATCTGCATCAGGCGCTGGTTCGACGCCTCGCGCGCCGCGAGGATCGCCGCGTCCGGC
ACGTGCACTACTACGGGGTTGTGCAGTTTCAGGTACGAGCCCGGCACGAGCCCCTTCTCGTCGTCTTTCGTGATGAACCACCAGCCGTCCGCATCCTATG
AGTGTGGCAAATTAGTACGAAAAGCGATGAACATTTAAACTCTAGAAGGTATGGACGCATGCATACCTTGCGGATCACTTCGACCTCTTCGCCCTTGGCC
AAGCGGAGCTGCACTTGCGGGTCCTATAGAATGACAGATAAAGGAAAAGAGAGCAGCGCTTAGTGTTGCCTCACGTAATAGCAAATAGTGCCACAACAAC
CCCACAGCCTTATGGAAAGCGCACCAACCTGCGGGATGAAGTTGTAGAGCGCCGTGGCCTTCTCCTTGCGTGGGGGTGGGGGCAGCGGCGGTTGAGACGT
TCTAAAAAGCGAATAACATACAAAGAGAGGGAATGATATGGTGAGAACGACCTGCGCATACACAAACACAATAGCCTGATAGCCTGACCGCATGAAGCCG
CAACGCACCCGAGCTCTTGCTTCAGCCGCGCAGCGTCGACGAACGCAGTGGGGATCGCGCCGAGGCTCTGCGGGGCGCCTCCGTTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGCAGCCTTCTTCCACATGTTGACAGACGTCGTCGCAGCCACCTATAAACGAGGACGGCACACACACACACGCGGGCCAGCCAGG
AGAACGAAATGAATGAGCTGAGCTCCTCCAACAATGCCAGCCACAGAGCTGCTCCTATCTCCAAAGAGCCAAAGGGGGGAAATAGACCGCACGCCCGCCA
TCCCTCGCCACGTACGTACCACTTTGTCGCCGCACTTTGCGCACACGTCGTCGCCCGCAAACTCGCCGCACCTGCGAAGACAAGCAAGCAGATACCGGTA
TATTAAAGCTCCGCCTCTTCTCTTTCCTCCTCGTCCCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACGCATGCGAGCGTAGGATCCCACACACA
AGAGAGACCAACAGAGTAACTCACTTGGGGCAAATGGACGGCATGCTGCTGTCTGCTTTGGCTGCTTCTCTGCGTTCGCTTTTGCCAAGTGGCCTCGCTG
GTTTTGTTTTGCAAGTTGACGATCTGAATGATCGAGCAATCGAAAGCGAACTGGACGGAACAACACACTGCCCTTCCTCAGATTATCATCTGGCGACTGA
TTCGAAATTCTGAGTTAATCAGACAATGTCTTTGATCACCAACCTGATACTGATTCAAAGAAAAGGAAATGAATCAGTATCAATTGTTTGAGAATGAAAG
ACTATCTGAGTAGATCAGATTCAAACAGAATGGTGGCTTTCTGGGTCTACAGTGCTTGGCTGGTTGGCAACAGAATTTGAAAAGACAACATGGACGAATT
GCGCGCAGTGATTCGAGATGCGGCGCTCTCCGCAGAGAGCTACGCGGTCGCACTCGCGCTGGGCGTGTGCGTGCGCT