Description :
From Genome Similarity Track
Location :
scaffold_18:94834- 96101
Transcript NameFunction/comments
Plaha_PHALS_05465myosin-like protein

Sequence
1267 bases(100 bases per row)
GTGATCAGAGCATTCTTGTGAGTGGAGAAAGTGGCAGTGGAAAAACAGAGAGCACGAAATTTCTTATGGAATACTTAGCGCAAGCAGGAGTGACGCATGT
TGCATCCACTGTAATTAGTAAAACTCCACAAGGTATTGCAGCTAAGGTCCTACAAACGAATATTCTGCTAGAATCTTTTGGAAACGCGCGCACATTACGC
AACGACAATTCAAGTCGATTCGGCAAATTCATCAAGCTTCACTTTACCAGTGGTGGTCGACTTACAGGTGCCAGTATTCAAACGTATTTGCTTGAGAAAG
TGCGGCTTGTTTCGCAGTCAAAAGGCGAACGAAATTATCATATTTTTTATGAAATGGCGGTTGgcgcaaaagctgatgatCGAAAGCGCTGGTTTCTGGA
CCCACCAAAGGGTCACTTGATGCCTTCTGGAGACCACGGCGATGTCTTAGAAGCCTCACGCCAATTTTTGCATTATCGATATTTGAACCAAAGCGAATGT
TATCAGCGAAATGATGGTGTTAAGGACCCTGAGATGTTTCAGCGTGTCATGGAAGCTATGGATATTGTTGGCTTTACACTGACAGAACGTGCTGGGATTT
TTGACACAATCGCAGCACTCATGCACATCGGAAATTTGTCGTTTGAGCACGATGAGAATTGTGATAGGGTAGGGCAGTCACCGGGACCTGGACAAGGCAA
ATCAGACCTGGCACCGAGCTGCATCTGGTCACGCGACGCAGCAGCCACACTGCTGGCTGTGGACGCGACAAAACTCGAGTTAGCTCTGAGTGTGCGACGA
ATTCGTGCTGGTACCGACTTTGTGCGAATGAAACTTTCTGCAGCTCAGGCTAACAACGCCCGCGACGCATTGGCCAAAGCCCTGTACGGACGTTTGTTTA
GTTGGATGGTGACAAAGATCAATCATTTTCTTCGAATGGATGACAGTGAAAAAGCTAAAGGTGGACTTCATTTTATTGGCATTCTCGACATTTTCGGGTT
TGAAGTGTTTCCAAAAAACTCATTTGAACAGCTTTGTATAAATTTTGCTAACGAGACTTTACAGCAACAGTTTAACGACTATGTATTTAAAGCTGAACAG
CGCGAGTACGAATCGCAGGGTGTTGACTGGAAATACATTGAGTTCTGCGATAATCAAGACTGCGTTAATCTCATCTCGCAGCGACCAACGGGTATTCTTT
CACTTATTGACGAAGAATGTGTCATGCCGAAAGGAAGTGACACGACATTGGCTTCCAAGCTTTACCG