Description :
From Genome Similarity Track
Location :
contig_229:9483- 10856
Transcript NameFunction/comments
g14366.t1hypothetical protein

Sequence
1373 bases(100 bases per row)
AGCTCCCGATTTTTTAGCTGCTGGATCGTATTGCTCAGCAGGGAGCGGCTTGGGCCACGAGCGAGACCTGGATCTGGATCTACGTGGGCGCTTGTTTCCA
CTTAGAGAAGGACCAAATCGACTCCCGTCTCTGGACCATGGCGATACGGCTGGAGGTGGGCCACGATCGTATCTCGAGGACCGATTACCATTTTTCAACG
CAAGAAGACGATCTCGTTGCCGTAATGGGGTACTACGTGCGCTCCCATTTTGCGATGAAAGAGGAGACGGTCTCGGTGCATTGCGGTCGCTTGAACAAGA
TCGCCTCGGGGTGCTTTGGAACCTCATATCTGCAGCAGGGGAAGAGCATGGGCTGATACTCACGCCCGCCTTATACTCCGTTTTCAACTCTAAAGGTCCC
CCAAAGTCATCCCGGAAGACTTGTGACGCCTGCTTGGCGTCCTCGCGATTGTAGAAGTGCAAATATACCGTACCAGATTGATTCTTCATCAGTCTCTGCC
AGTTTTCGCGTGGGATATCGCAGCGCGGCACGGATTTGTTGATTGTATAGCGCTTCACCAGCGAGGCAGCAAACTCCTCGCGGTCGCGATCCTGATTAAA
TCGGATGCCGGTGGACCTCCGCTCAAAACGCGCGTTGCGAATAATCACCGTTATCCATCCACGTAATGACTGCGGTACGAACGCGGTCCCGTACATTCGT
TGTTGGTAAAACTCTCTGTCCTTAGGGCGCTCGAAACGCAGCTTTTCATAGCAGTTAATTTCGCGAGTCTTCGGTTCGTCGCTGATGTATTCATCAGAGT
CGGGGTTTGCTTTTTCTTTAGACTTTGGGGCAGAAAGTGACACACCAAAGAACGAAGCGGCGTAAGATTCCCGATTCAACGCAATTTCAGGCTTCGTAGC
GCAGCTCAAGCGAGGGATCAAATCAGGCAGTACTTCTCCATGGACGTCGAAAACCTCATACCCAATCGTGGATGGTGCTGATGCCTTATTAGATTGAACC
GCCAGCTCTGTTATTGCCATGAAGATCGAGTTACGCCTCTTGGACAGGCGCATCATGGCTCGATCTTGCTTAGAAATCGCCATAGGCTTCACTGGCACAT
GGTTCTTCGTCCGCTTTCGTCGGGGGCGTATAGGGTCAGGCTTTGACAACTGCGGGCTCGATTCAGGAGACGGCAGTGGTTTCAATACGACGGGAACACG
GGACTGTAAAAAGCGCTTGGTACCACCCATGTTCACTTGCCCCCGAGGTGCCTCTTTCTGACTCCCTGGTTTTGCAAAAGATCGCTTCGGGATCACAAAT
TCCGAAGCATTTGCAATCGTGGCTGATCCATTTTCAGCAGTTTTCCTTGGGATTGGGATCGCGTCGGGCAGTA