Description :
From Genome Similarity Track
Location :
Scaffold_222:9483- 10689
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_222-fgenesh-gene-0.7Transmembrane protein

Sequence
1206 bases(100 bases per row)
GCTTACTCCATCTTCTTAAGCTTCTCTTCGTCTTCCTCGGCCGCGTGCTGCTGAGCAAACTGCTCAATACACGAAATCGCGAAGTACgCGATGAATGCAA
CCATCACGTAAGATCCAATCTGGGAGATGAGGCCACTAGTCTTGGCCGCACCACCCGCAGCGTGCTCCACaGAGGCCTTAGCACGGGCTGAGTGGAACTT
CTCGCGGCATTCGAGCAGGAACTCACTCACACGCGCATCCAGCTTCCAGGCGGCGGGCGTGACGCTCGCGATGAAGGCTTCAACCTGCTTCATGTGGGCA
TCCGTGAAGATTGTGATGAAGAAGGCAGCCTGCAGGTTGACCTTGATCAGGGCCTTGCCAATGAGGGTCGCTCCAAAGAAtGTCcAGAAGGGCATGAGGA
AGTGACCACAGCAAATACCGCAAAGGTCAAACGCCACGTTCGGCCACGCCGACATGAGGAGGACACCCCAGAAGCCGTGCTTCTCGAGGAACTTGATCAT
CCAGTCCTTCATCCAGTTGAGCACGTTGTACTGCGACTTGGATTCCGTGATTTCTTCGAACTCTTCGTTGCGCTGACCAGCAAGACGTGCAGCACGGCTA
AGAGCGTACGGTGGAATCTCACCCGCCGCCGTACCAGCGCCCCAGAGCGCACACGGCCAGAAAACCTTGCAGAAGATGGCGAAAAACGTGACCGGGGTCG
CACCGATGTCCCCCTTGCATTCCGCAGCAAATGAGCGGAACCACATGTCTTGGCGCGAGTCGAAGTCGAGCGAGTTGCAGGCTTCAGCGCCCTGCACGAC
CATGAAGATGTGGGGGAAGAGGAAGAGAATACCCGAGTGCATGCCCGTGCCCAGGCCGACCGACGAGAGCACTCCGAGGCCGACCCACCAGACGACAAAC
TCGACATTGGTGTTGAACTCATCCAGATACTTATGGTGGTCTCCCTCGACCATGGACgCTGTAACCCATCCGAGCAGCAGCGGCAGGAGCACAAACCGCG
TGGCATTGTGCTGGAGCACATAGAGTGCAAGCCACTTGAtGAAGCGCGCAAGCACGATGCTGAAGTGGTAGAGCACACTAAACGGGCGGCGGAAGAGCGt
gAGCTTCTTGCGCTCTTGACGGAGCTGCTCTGCGAGCTGCTCCTTCGCGGTCTTCTTCACGGCCATTGTCGCTCCCGTAGCTCCTCGTCGTTTCGTGAAG
TGGAGG