Description :
From Genome Similarity Track
Location :
Scaffold_283:9482- 11349
Transcript NameFunction/comments
Phymu_g8040conserved hypothetical protein

Sequence
1867 bases(100 bases per row)
AGTTGGCGAGTTGTCGTGAATCGAAAGAAGTCACTTTTCGTTTAGCCTTTTGAGTCAGCTTGGTCGTCATGGGTCTCGAGGAAGGCGGCATGAAGCAGCC
TCTGGACGAATCCAGGTTGAACCGTAGGCCGTGGGCGTCTTGGCGTCTTGCGGTGGTCGCCACGCTCGGCGCGTTGCTGGTCGTGACCCAGTTGACCAGC
TACTCGCCCCATTTCCACGCACATATCGCCAAGCACCGCATTCTTCGCAGTCTGCAGGAGCAACCGGCACTTCGACTGTCGTTTGAGATCAAGCGTAAGG
CCATGTACGTCCACGGCGCGTCGACCTTCGACGTCGTtgcgacgccagcaccacagcgCTCGGGAGATGACAACACTATGGCGTACAACGGAATGGCGtc
gttcgagaaggacgGCCACGTCCACGAATACTCCCTAGTTGACGGTACGACGTACTACACGCGTCGTCCGAACGGTTCACCTGTGACCGAGGCGGACGCG
GGATGTTTGCCGGCCGGATCGGTCCCGCCTATCGGGAGCGTCTTGAACGCCATTCACGGCGCCACCACAGCTCAGTCCGGTGGTGCGAACGACAAATGCC
CCGGTGGCTCCGTCATGGTGTTCCAGTTTGCAGGCGAAGACTTCGTGCTGTGCTCGCGTCAATCGCTTCAGGACGGGTTCCAGATCTTCGGCAAGCACTT
GGACATTGGCGTCAAGTACGAACAAACCGCTCCCGTTATTGTAGCCCCGCGTGTACCGACGGCGGCACTGGCCTCGTGTGGGAAGGCCCCATTCGGCGAG
CGTATCACCCCGTCACTACCGTCGCTGCTTACccgctccttctccgagTGGAGCCGTCGTGCGTTGCGTGCGGAGGAATCTCAGGGTTTGTTCGATAGCG
CGTGGGACCTCATTACCGACAGCACCTGTGGCTGCAAGGGCGCTCAACGGGCCTGTGTGTTTGTCGCCGGTCTCAGTTCGTACGATGACCGCGGCCTGAC
CGAGGACGACCCGGAAGGCTACTTCGGCGATGAAATTGGAGACCATTCGCCCTGTTGCTCGAGCAGGAAGTTCATTACGTTGGCTACGAAGGAGAACTCG
TGGAATGACCCCGTATTCCAGCAACGGCTGGTTGATCTGGTTATGGAGGTGAGCGGTACGAGTGACCCAGCTACGGGGACGATCAAGGACACGATCTACG
TCGGCCACTCGATGGCGAATCTCATGTTGGCTGGAGCTATTGCTAACAAGAAAGCCACGCTTGATCCGTCCTCGACGTGGGTAGCTGCCAGCGCCCCAAT
GGAAGGAAGTATGGGCTCCAACTACATTCAGGAGTCGTGCAATGGACAGCAAAGTGGCTTCGTGGCTAGCAtcattgagctgctgggcaactGTCCTGCT
AACACCGGAGAGACGTCGTTGGCCTACCAGGGCTCCAACTTCTCGTCGCAGCCGTTAAACGATGCCTACGCTGGTGCTCAAGCTGCGTACGTCGAGAATG
TGGACGCTGTCCTGTGCAGTAACAGCTTTACCGGCTTGGTGACTGTGAAGGCCGCTGTCTATGCGTTGGCTGGTGAAGTGTTACCCCACCATTCCTCAGA
GAACGATGGTATTGTTGAGTACTCGAGCTGTACAATGGGTCTGCCGCTGGACAGCTTTGATGACTCGTACGAGAGTGTACGATACAGATCCGCGCTAAAC
CACGTGGACACTTCATTCCGGAACGGCGACGGCGTCTTTAGCGACTCCAAGAAACCTTTGAAATGGTTTGAGTGTCTCCTGTAGGTAGAACACGCACGTT
TACAGTTTGTTGTAATTGATGGAAAATGTCGAACTTGATGTACATTTACCTCTTGGTCTTGCTTCGT