Description :
From Genome Similarity Track
Location :
Scaffold_377:9480- 17641
Transcript NameFunction/comments
Hyaar_Emoy2813947Eukaryotic/viral aspartic protease, active site

Sequence
8161 bases(100 bases per row)
CACAAGTAACCGTTGGTCATGTGAAGGGTTTCCACACGACCACACCCCACCTATCCCCAACTCCGTCAAGACAGACATCGACCTCAAGCCACCTAGAAGA
GTTCAACCCGACCGCCGACGGGTACACAAGTTGAGAAAGAACAAGACAATACACACTGTCCGGAGTACCCCTTCGTTAGTCGGTCGTCCGGGTGCCAGTG
GATAGTTGTATCGCTTTGTAAAATGAGCGAATCTCACTCCACCATAATGGTCCGCGTGCCCGGAACTTCTGGTGACTCGGGATTTCACCGTGAATCCCAG
AGCGAAGATGTCAAGGTCAAGGTTGAACAGGGGATGTAAGTGTAGGCGAAGAATGGATCAATGCAGGCACGTGGTCATCAAGGATCCTCAGTTCGTCAGA
GTTTTGGTAGGCGCTCGGGTGAAGTGGAAATTAAAGCGGAAGATCACTCAGATGGTTATGCAGAAACACCTCTTTTCCCTCCTGAGGCTCCTTCGGGGAT
CGCCGCGCATCGTACTGCAGAGTAATACCCGCTAGACGGAACACGTCTAGCCAAAGCAGGACATGTTTCGTATAAAACCAAAACTATATACAAAGAAAAA
GATCGAAGACTGCGGCTACAAAGTTACGAGCGCCTGAATCTGAGGACGACGATCAGGAAACAAATGTGGCAGAAGCGGCCAAGATAGAAGGCTGGAAGAT
TGATCAGCTGCAGAGGCGTTTGTACTGGACCCAGCTTCAATACTTACAATCCACAGATCCGGTGCTTACGATATCAAAACCAGAGCTGATTGGACCGATC
CGAGGTCCTTCGATGGCTCCACGAGCCGCTACAAGCAAGATGAAAGCGTTGCAACGTCTTATTCAATTTCGTCAAGGCGCAGGTTTTGTATCGGGGGCGT
TCAATGTGCAGGTCTTTCTTGACTGCCACCTGGAACAGGTGACCGCGGCTAGTCGATCACTGTTTAAAAAGCTGATATCACCGGTAATTATGACTCGGCC
GATCGCGAACTCATGGCCACCGTTCAGGTCAAAGGGGAAGAACGTTTTCCAGCTGTGTCGTCGCATTATGTCTCTGATGAGTCCATTGCGGAGGAAAGCG
ATGACTTGGAGATCAAAGGAATGTCGTTGGGACCTTTTGGAGCAGCACTTTTGCGTGACTACCATGGAAATACCGCTCCGACCACTATGGCGGTAGGTGC
AACCACCACAAAAGTCCCTGCTACGGATGAATCCGACCAGATGCAAATCTACTTTGCAAAAGCCATGGAGAAGTTCTTACACGACTAACACCGTCGACTG
CCCCGTACGGCGAAAACTGGTCATCCCACCTCCCCCAACCACAATGTGTTCGGGGCGTGTATGCCGGACACTGAGATGAAATCAGCTGACTCGCACAACA
GCCGCGGCAAAGCATTCGATCCTGACGATCTCGATATAGACAATCTACGACAACCCTAGTTGGCTACTACTGAGGAATTAGGAGGGAACTTTACCGCGCA
ACAAATTCGCATGTCTGTAAGTGCCGATTTAAAAGAATGTTCTGGCAGCGATTACGATGACGACCGCGCTAGAGTATGGGTACGAAAGGTCTGGTCAGCT
TTCCTGCGTGACCAAGCCCCTGAATCGGAGAAGTGTATGGTTTTTGGTTATCTGAGAACCGGCCTAGTGCGTAAATGTACTCCCAACTGAGTCGATCGAC
ACGTAATAAGTGGAATAACTTCTTCGAGAGCTTCCTTTTACAATACTGTGGACGCGGCGTCTCCGCTGGTAGCCAGTATTACCACACCTACAAGCGTTCC
AATGAGACTCCGTTAGAATCTCTCTATCGATTGAACATTGCTGGAATGCGATCGAAAGTTAATGCGAAGGATGGCAATATCTCCTATCGCCGTGAACATG
TGGAGCATTATATAGAAACACTGGACGATCGAGACCTCGTGAAAAACTAACCCTGATGCGAATAGACAACGTGGATATACTGGAGGAAACGCTCCGTACG
TACGAGCATATGCAGAAACGTAAAGGCGACCTCCCGACCAGCTTAAGCAAGTTCCGCTCACGATCAGCCTCACCATACACCCCAAGTCCATCGAAACCGG
CCCGAGCCGTGCGTGCAATCCACTTGGGGGGCGTTGCAAATTCTTCGGAATCAGACATAAGCGGTTCAGACTTCGAAGAAGAACAACGACGTGTTTACAG
GGCTACGTTAGCCGTTAAAACGACGGATCGAACAAGTGAACGTCCGACTAAGCCAAGACTGGGTTTTCTTGAGCGTGATTAAGATCGTGCAGGAGGACAC
AAGTCATGCACTCATTATGGGTCAAAAAAACATGATGATCGTGAGATGCTGGAAACGATTGACGTTCCAGAAGTGCGAACGCCGAGGTCACCCCTCTGAC
AAGTGTTTCTACGGTTGTGGAGCGTGTGGAGAAGTACACGAAAGAGTCAAGTACATGGAAAAGTTTTACAACATGCTCCGCAAGTGGTACGTGCCGACCA
AACATGCTGGAATGCTGCCTCCTGACGCTAAGAAGATGTTAAACGAGATCGCTCGCCAGTGAGGAATCTGGTACGAGCCGAGCGTTCTAGGCTATGCATA
TACGCATTAATTGAAGGAGAAGGGGTCGATAACAGAGTTATTCGCCTGATCGGTCAGACTTTCAGTACATGTAATTAGTATTTTAGTTGTTTCTATTCAA
TTGCAGTTATGACGCGACCGGATGGAATATGCACCCTACCAAGATGGAGCTCAAGTTATCTCCCGGAGAATCACGTGATTACTGGAAGTATCGTACTCCA
AACAAGTGGTTCAGGCAAGCCAAGGCTGGAGGAAAAATCAACAGTGAGAAGACCGACCTACTGTTTGACTCAGAAGCCGAAGTCTCGATCATCGACACCA
TCTTTGCTCGTAATATTAGCTGTGCCATTGATGAGATTCAGAAGCAGGAATATGTAGGTATTGTAGAGAATTCATACTTGGCCAAAGCCCACACAAAGGG
GAAGATTAAGGATGGGTCAATAGTCCACTACTTAGATGTTTGGTTTGGTGACCAAGTAGGTTAGGAAGAAATTCTAGGAATGGACTCTATGGTACCTGCC
GGGATACGTCTGGACCTGGCGGACGGGACAATTTGTTTGCCAAACGAAGTCAGAATAACCTGGAAGGGAGAATACCACCGTATGGGGCGAAGATACAACG
CATTGTCGCGGATAAAAAGTACTTGGCGATCCCGGTGGGTAACTCCGTACAATCCAACGTTGGTTGGGGACCACTGCAGTCAAAATTGTGGTTAACACGC
CACTCACGCTGGGTACCTACAGCTACGACTGGACCTGGAAGGTTGAATTGCCTTCGCTTGACCAATCTGACTGATCAAGAGGTGATCATTCAACAAGGAA
CACCTTTCGGCCAATGGATGCCGGCGGATATGATACCGCGATCACCCGGGTACGTGTCCGTGGGGTCACGACGATATTAGGAGTGGAAGACACTCACGTT
TGAAGCAACCACGGAAGAGGAAGAAGACGAAGAATGACCTGAAATATATGAGCTGTCGATTGAACACCCGTCATATCCGACTTTAACGCGTATTCTATAA
CGACCGCCGAGGGATATAGCAGAGACGATTGTGGAAGAAGAGGAAGTAAAGTCGAAAGTTGACATGCCAATATGTGATCACGCGGACAACCAAGGGTAGC
CTTGAGGGCCACAATCAGGACAATAAGCAGCGGGTATTACTGCGATCACCACCCCCAGTAGGACTAGTGACCGGGACGACGGTGGTACGGTATGGGAACC
GGTGTCTGATCAGCTGGAGCAAGATAGTGAATCCTAGAGAGGACTACCGATGCGATTGCCAGTGATAGTCGACATGAACACCCCTCAAAGTGATTAGAGA
CGTCAAGGTTGTGCGGGACCAGTTAGAAATACAGCCAAACGATTGTAAGGGAGAAGTCACTCTTGAACCGATCAGTGAGATGGTAGCTGATCGTATGCAA
GACCGGTCCACCATCCACCCAGACGTGATCACGGGTGAGGAATGTGAGGCACATCGACCATCCAACCATCAGGCAAACCAAAAAATACCGATTACAAACG
AAGGAGCACACGAGGGCTCGTCACACCATCACGAAAGTGGAGTGTTGTTCGCGAAGGATGTTGGCCAACATATGGCAGTCTTACCAGAAGTAGACGTGAT
TCTGAGCGGGGTGAAAATTGACGATATACAGGTGGGCGATCCAGGAGTCCCATTGACCAATGAACAAGAGAACTTATGTCAGCTGATCTGGAAAAAACGA
CGCCTTCTGATGGGTAAATTCCCTCCCACCTGCTGCGCGAGGTGTAATTTGCGATTCAGATGTCGGAGAAGCAACCCCAATCGCACAGCGAGTAAGGCCA
GTCGCCCCAAAGTTCCGCAAAAAGTTTGCGGACCTGATCAAAGGGTTACTATTGGCCACGATCATATGTCCCTCAACTTCACCATGGATGTCGCCGATCG
TAGTGATCGTTAAAAAGAATGGGGTAGATATATGACTGTGCGGAGACTACCGAAGAGTTAACTAATTGACGAGGCTGATGATATATCCCTTGACCCTGAT
CGCCGACTTTTTGTAGGATCTGAACAAAGCGCTATGGTACTGTTCACTGGACATGGCCAGCGGATTATGGTTTGTGGAGATGACGGAAAGAGCACGAATG
ATCTCTGCTTTTATCACTCCTTCAGGTCTGTATAAATGGTTACACATGCCGTTCGGGCTGAGGAACGCTCCGCAGATATATCAACGTATAATTGATAACG
AATTCTATGGGTATCTTACGATCGATTATCGGCGGAATTCAAGTGCCCACGAGGTGTCTCAATAGGTCGATGTGTTTACAGACGGCAAGACAAAACCGCA
CCGAAATTTTTCGATTTTAGGACGGAGGTCCTACATCCATGACATTCTAATCCCAGCGTCATCCTGGACGTCTCTATATCAAAAGGTTAACAGATTATTG
GAAGTATGCGATCAGTGGAATTTGTCGATCAGCCTACCTAAGAACGTCTAGGGACGAAACAAGGTTGATTACATCGGGCATTAAGTGTCAATAAAAGGAA
TCGAAGCTGACCCAAAGGATCTGGGTTCGTTGGTGAATATTCCTTTTCCACAGACATAGCGGTCAATTAAGTTCTTCCTAAGAAACCTGAACTATTACAG
CTGATTCATTAAAGGCTTTGACATATACGCCTCCGTTCTGTACGAATTGAGGAAAGCTGATCTTTATGAGAGCGGGTGTTCGCACAACACGGAAGAGGGA
TGATTATCCAGCTATGATCACGTCCGTAGTATGAAGAATTATGATGACCGCGGGCAGTGGTCTGCAGGTGATCACGATCATCAGCTGATGACAGTGAAAG
GTCAGGATCAATTTAGAGTGAAAGGGTCTGATGGCGAAAATACTGCTGGCCATCGTTGGGAGAAGGCTATGATTGCGTTCACCATGTTGAAGGCTGAAGT
AGCTCAGACCTCGGTGCCCAGACATTTGACCCGGATCACCGACCAGTGATCGTGGTATATGCAATAAATGGGCGGTATCCGCAGCTTTGTTACAAGAACA
CTATGGAGTGGGTTGGCCTGTCATATTCACAAGTTGAACGTTAAATTCTGGCCCTGCTCCGAATGTTGGATATTTGCTTTACGTTATTGGTCTCGCGGGG
CGTTAAGGTACTCACGAGACACTCTACCTTGGAATAGTTGATGCAGTCATTAGGGCTCAATGGACGACTTGGAAGATGGGCAGCTTTACTGTCGCCTTGG
ACTTTGGAAATTAGTCGATATAACAAAGGGGAAAACGATATCTTCGGCACCCTCGCAGCGAGTATTACAGCGTGGGAGGAGGTGAATGAGATGTTGATCA
CGATCACACCACGAAAGCAACCGAGACAAACCATAAGTATCCCTCCCCCTACGGTCAGACATGGCGAAGTGCTTTTGGCCGTCAGCTTTGATGGGTCAGC
AAGTGTTAAGAAAAAAGGAGGCGCTTAAAGCGCAGGGATATGGAAACTGCCCGAGTGGACAATACTGTTGGCCGCGTCGAGGTTTGATACTGAACTGTCC
GTGAATGATGTAGAATACAACAGGTTGCTGCTGAGTTGCGAGCCGCTAGCGAAACAGACAAGGGGGCGAGTGGTTATCTGTTGTGATTCCAACTTGGAAA
TCAGGCAGATGCGGGGTGAGATTGATTGCAAGGCACCAGGCTACAATTACTGCGTTTCAAAGCCCTATATTAACTCAGGTCGTGGCCGACACATGAGGTT
TTACACGTTAAGCGCGATTGGAATAAAAGTGTGAATCGATTAGCCAGCACCACTTTACAGCTTGAAAAAGGCATGGTTATGCTAACTGATCAGGATTGCC
ACGATCTGATTACCATCAACCGACTGGACGAAATATTGACGTCAGCGTGCAATGATCAAGTGATCAAGATGGCGGCGATTACACGATCGACTTTGCGAAG
GAGTGAGGCGTATACCATTATACGAGAAGACGTGATACAGCAGGTGCGTCTCGACCGTATAAAACAGGCGCAAGACGAAGAAAGCTGGATCGCTAACCTC
AAGCTTTACCTAGACGGAGATGTAACGGAACTGGGCGCTACAGAAACAAAATATAGTGCCGTGATTGTACCAGACTACGTGGTAGATGAAGGCGGATTGT
TGTATTATTTGCCCGCGATCGGCAACATATTTCGATGATCGTTCTGAGCTCGTTCGTCTTGTGATCTAGAGGCTGCTCAAAGATAATATTCTATACCATT
ACCATGCAAGTCTGGAAGAAGGGCACTAAGAAGCGGCCGCACGTACTAACGCGTGCGATCACACCTTTATTGGAGAGGACTTTTCCGGAGCGTGCAACAG
AATGTGGGGAAGTGTGTCGACTGCGAAACCGGGAAGGGATGTCCGGTCCTACATGGAGAATTTCCTGGAAATATGCAAGCTACGCAACCTTTTCAGAATA
TGACAATGAATCATATCTCTTCCTTGCCCCGGTCATTCAAAGTAAACGCGAAATTGCTTCTTTGTGTCGATTTGTTGTCCGGCTGCGTGATCGCCAAGGC
TAGCTCATCGAGAACGTCCCAAATAATTGTGGAAAGGTACTAAGAATGCGCCTTCCTGTGATTTGGAGCAAGCGAATCTATTCGTCATCATCGCAAACCT
GGGCCCATGTCGGATTTCTTTCGCGCATTCAACAGTATTGCCGGTCAAAAGCAGCTACTAAAATGATGTATCGGCCTCAGGCAAATGGCACCACCGAACG
GATGGTCCAAACATTGACCCGGGCGCTCAAGATGTATGTCACGGATATGAACCATTAAGACTGGGATGATTAGGCCGAGCAATTAACCTTCGCTGTCAAT
ACGGCGCGTGACCGAGTCCGTGGTGATACATCGTTTTATCTCATCCACGTATGATACACGCGATCGACGTTGGAGGCAACCCTTGAATTGGGGTGTACTA
AAACACGTGATCGTGATCTTAGAAGATAGCGTTATCATATATAGCTACAGTACCAACGTACCTGGGTCACTGTGAATGACCGGCTGAATGAAGCCATTAA
GAACCGGGGTGATCTACACAACAATGATCGAGTACCACATGGAATAAGCTGTAGTATCCAAGTGTAGCTGTATTTAGATCGAGTTAACGAAGGATATGCC
AGGAAGCTGGCTCACATGTGGCATGGCCCATTTTGGGTGATCGAGAAGTGCGGATAACACGCAGTACGGCTAGAAGTGCAAGGAACCCCATACCGACTAT
TCCCGCTCATGCACATATCTAAGCTTAAACTGGTCCGAAAATTTCGTGACCGACCTATTGCACGGCTGCAGGTGGAGGTAACCGAACGATTGGATTTCGA
TGGAGCCCTTATTCCGGAGGAAAGTTGGGAAGGTAATTTGGCTGAAGGGGAATATAGGTGAACAGTATTACAGGTATGCGATCGGGACGGAAAACTCGGT
ATGGAAGAACACACCAACTGTTCCTGGTCCGGTGGAAGGGTCATAACGATGAAACATGGGTGGATGGAGCAAACCTCAATTGTGGTGCAAAGTTGCAGGA
ATTTAAACGTGATCGAGCTAAAATGAAAAGGTTTGCAGTGATGCAAGTACATGAAGGAGAA