Description :
From Genome Similarity Track
Location :
Scaffold_1973:948- 5054
Transcript NameFunction/comments
Phypl_g14482hypothetical protein
Phypl_g14483hypothetical protein PHYSODRAFT_341169

Sequence
4106 bases(100 bases per row)
TGATGGTTTACCCAATGCCTCTGATCAATGATCTGCTCGAAGATCTGGATAAGGTGCTGTGATATTGTTCGCTGGACATGGCGAGCGGATTTTGGGCAGT
GGCGATGACGGATCGGGCTCGTGCGATCTCGGCATTCATCACCCCATTTGGACTTTTGAGTGGAGTCGGATGCCTTTCGGCCTCAAGAACGCCCCGCAGA
TCTATCAGCGCTTAATCGATAATGCGTTGTACGGATTTACGCGGATCCCGCGTTCTGGGGCTAACGGGGAACTGACAGATCTGTTTGAGACAGGAGAACC
TGAAGATCCTGGTAAGCCTTCGGTGTTGGGTCGTAGATCTTATATCGACGACATACTGATACCGGCGAGATCATGGGATCAACTATGCGATCAAGTAGAT
GCCCTACTGGAGGCGTGTGACAAGTGGAACTTATCGATCAGTGTGGTGAAGAGCTTCTGGGGAATGAACAAGGTGGAATACCTGGGACACCGAGTGTCGA
AGGATGGGTTGGAGGCTAAACCCAAAGACCTGACGGCGTTGACTGATCTGCCATTTCCGGCGTCACTACGATCTATGCAATCTTTCCTGGTCAGCCTGAA
CTACTATAGTCGCTTTATCGAGGATTATGCGATCTACGCCTCAGTGCTGTACGAGTTGCGAGAAGTTGATTTCACCGCCATGACTAAGAAGCGGACCAGT
GACCAGATCACGATGCTCCTCGAAGCGGAGACCTCCGGTCGGGATACCACATATCTTGATCTGGGAGATCGGGGTGTGGTGGCAGCAGATCAGGTAGCAC
AGAACTCCTCCGATGTGGACAGACGGTGGATCCATACGCACCAAGCGTTCAAGAGGTTGAAGGAGAAAATCACGACGACGCCCGTGCTGCGGCATTTTGA
TCCAGATCGCCAGACTGTAGTCGTGGTATATGCCAGCGATTGGGCTATATCAGCAGCCCGTACGACAAGGTATACTATCCGATTACTTTCGTAAGCCGTA
CACTCAAAGCGAACGAGTTGAATTATGGAGtggtcgagaaggaggtATTGGCGCTATTGCGGGTCCTGGATCTCACCTATAATCTGCTAGTCGGCCGACC
CGTCCGGATCCTAACTCGGCATTCAACACTAGCATGGCTGTTCAGATCCGCTGGCCTCCAGGGCCGGTTGGGTCAATGGGCGGCGTTGTTGTCGCCTTGG
ACGCTCGAGATCGTACGATGCTCGAAAGGAGAAGACGAGATCCTGggagcgcttgctgccagtATCACGCCCAGATCGGAGGTCGACAAGGGCCTGATCG
CAATCGCCCGCAAGAAAGAGCCAAGGCTCAAGATCCAAGCCCCGATCCCGACCGTGGGAGCTGACGAGGAACTGTTCGTGTTGAGTTTCGATGGATCTGC
TCGAGTCaaaagaggaggaggcgcctACAGTGCGATCTTGTGGAAATTGCCCGAGTGGACAATGCTGAAAGCCAGATCACGCTATGCCGACAGTCTGACG
GTCAACGAGGCAGAGTACCATGGGCTCCTGCTATGCCTAGATCTCCTCGAAGAGGTAGATCGGAGACGCGTAGTGATCTGTGGCGACTCGAACTTGGTGA
TTCGCCAGGTGAGGAGCGAGTTCGATTGCAAAGCGCCGGGGCTCACACTTCTGAGGCAGAGGGCACTAGATCGGTTACAGACATGGCCAGATCATGAGTT
GGTCCACGTAAAGCGTGATTGGAACGGTAGTGCAGACAGCCTGGCTGGAGCAGCCCTCTAGCGTCAGTACGGGATCAAAGTTGAGGACGAGTCCGAGAAG
CAAGATCTGATTACGTTGAACCGATTAGACGAAGTTCTAGTGGCAAAAACTAAAGATCAGGTAGTACAAATCTCGCCTGTACGAACTAGAGCCAACCCCA
GATCCAGATCGAGACCCACGGTATTACAAGAAGAGCTCGTGCGGAACCTCCGGATCGAGCGGATTAAACGAGAACAAGACGAGGAGGCGTGGATCTCGAG
GTTGAAGAAGTATCTGGCTGGACAGGTGGGTGATCTGACTCAAGAAGAGACTAGATCCTGCAGTAACATCGCTTCGGATTATGAAGTAGATTTTCATGAT
CTGCTTTTCTACTGTCCTCCTACGAAACGTGCGGACGCTGGTCGAGATGGCCTCATGAGACTGGTGGCGCCGGAATCCCTGCATCATGATATCTTGCACC
ATTACCATGCGAGCTTGGAGGGTGGACATCAGGGAATTGGCCGTACATATCAACGGATCAGAGGTCATTTCCACTGGCGGGGCCTCTATCGGAGTGTGCA
TCTCCACGTTGGAGAATGTGTCGATTGCGAGACCGGAAAAGGACGGCCCACGATCCGGGGAGAGTCGCCAGGGAACATCCAAGCAACCTACCCGTTCCAG
ATCATAGCCATGGATCACATCCCCTCTCTGCCCAAATCCTACGAGGGAAATACGGAACTATTGATCTGGGTAGATCTGTTCACCGGCTACGCAATCGCGA
AagcaagcgcgtcaagaacTGCGCAGACGATCGCAGAATCTTACGAGGAGTGCGTCTTCCGCAGGTTTGGTGCCAGCGAAGTGATCCGGCATGATCGGGA
ACCAGGATGTATGTCCGATTTCTTCCGTGCGTTTAACAAAATCCTGGGGCAACGTCAGCGAGCCACGATGGCGTATCGACCTCAGGCTAATGGAACGGCC
GAACGAATGGTGCAAACCGTGACCAGGGCTCTCAAGATGTACGTACAGGATCTAGATCAACGGGATTGGGACGAATACGCCAAACGGCTCACGTTTGCAC
TCAACACCGCTCAGGACCGGATCCGCGGGGACACGCCTTTCTATCTGGTAGATGGCTGGGACCCTAGATCCACCCTAGAAGCTACGATTCCGGTAGGAAG
CACTCGTCGCCAAGATCGGGATCCACGACAGTGGTGGTATAAGATCCAACGCTATCACCAACAAACACGGGAGACGGTGAACGAGAAACTGCGAGAGGCG
ATTGCGGATCGAGCAGACCAGCACAACGGTGAAATCCGCCCGCACCAGATCGGGGTTGGATCTCAGGTGTGGCTGTACCTAGATCGCGTCAAAGAGGGAT
ACGCTCGGAAACTCACACACCTGTGGCATGGACCGTTCTGTGTGTCCGAAAAGATTAGCAGCTATGCCATGAAACTCGAGATCTCGGGGACCGAATATCG
CCTCTTCCCGGTGGTTCATGTGTCAAAGCTGAAGCCGGTGAGGGAATTCCCTGATCGCCTTCAGATACAACTGACGATCGCCGACGCGGATCGGTTTGAT
TTCGACGAGGCACTCCTGCCGGAAGACAGTTGGAGCCAGGATCTGGGGCCTGGCGAAtacgaggtggagaagatTACCAATGTCAGATCAGGCAAGAGGA
CGAGATATGGCCGAAACTACCGGGAATTCTAGGTGCACTGGCGAGGTTATGATGACCCGACTTGGGTGGACGAAGCAGATCTGAACTGTGAAGCATTGCT
ACATGAGTTTCTGCGGGATCGCGCGAACCGCCATCGGTTCGGTGTGATGCAGTCTCATGAGGAACCATGAGGCTGTGATCTGTCGGCGTAAGTTGGTTAC
GTCGATAGATGGACgtgttgaagaagctgcagggtGGCTGCAGACTAGGAAGAGGGGTACATATGTATATACATCACAGATCTGATGAGTGAGGTGTCGG
ATCACAAGATCCAAGTCTCAGACGAAATCGACTAGATCAAGATCTCGACGAGCTGATATCCAAGTACGCCGGGGGTCAAGGCTAATGGGAACGTGTATTA
CGACGGCAGAGAGTAACCTTCTGGGGAGAGAGGCCGTCGATCAGGATGGTGGGCCAGGATCTGGTGGAACTAGAGGGAGCAGAGCAGAGATCAGCATACG
TCGGACTCAGATCCGGCCAGGATCCGGTGGAGCTAGGGTGAGCGGAGCCGGAATCAGCGTATGTCGGACACAGATCCAGCACCCCCTAAGGTGGGCGTTA
CCACTCCCACGTTGAAGAACTTGCCGGCGAGGCGGGTGATCTGGTGCGCCGGGTGATAGTCAGGATCGTCACGATACTGATTGCGCCAAGGATAAGCGGC
GTTGCA