Description :
From Genome Similarity Track
Location :
Scaffold_452:9479- 11156
Sequence
1677 bases(100 bases per row)
GAAGAGCTCAAACCAGCCAGACCGACGGGTACGCAAGGTGAGCACAAAGCTATACAACAAGGCACGGATCAGAGTTCCCCCTCCGTAAGTCGGCATGTTT
GTGCAAGCGGAAGATCAAGACCCACATCAGCAATTTTGTGAGACCGACTTGATCACAATGGTGTTCTCGGATCCTCTGAGGTTTCTGTATTCCTCCGTGA
GTGTACTGGCGAAGATGTAAAGATTTCGCAAGAACCTGGGATAGAAGCGTCAGCGGGATTGGCGCAGACAAGTGGTAATACAAGATCCCCAGATCTTCAG
ACTTTCGGGAGGGATTTTAGCGACGAGAGATTGAAAGCGGAAGATCGAGAGATCGATCTGGAAGAAAAACGTCGACCTCCTCCCGAGCCCCCCCCCGAGG
ACCACCACAGATCATTCTACAAAAACCAATTTACTGGATAAAAACTCAACGGCAAAAGCCAAGCCCTATGCTTAATTTGACACATCAACTGATATGAAGA
AAGCCAAGAATACTACCGGATCTCGCGAAAAAAGATGAAAGTGCCAGGAGAGGAGGAGGGAGATCGCCATAATAGCGAACCGCAAAAATTGATGATTGCC
GTTAAGGAAGAATATGATTACGAATTGTCCGAAATTGCGGTAACAAAAACTAAGCGCGAGCTCGTAAAGGTAGCAGCGCAGAAGGAAGTTGGGATCGTGT
AGAATGGAAGTGTCATTACAGAAAGCTAAATATGTTGCTGAAAACGGACCCAGTATTCAAGATCCTGAAACCGGAGCTAAAAGGATTGTAAGGCAAGCCG
ATCACAGTTCCAGAACATGTGACCAGTCAGATCGATACAATCACTCTGATCGTTCGGATGTTAAAGGATACAGGCTTCTGTACATCTGTGCTCGAAGCGA
GGGATCTGATGAAATGCAGCTTGGATCAACTCCAGAGCATAGTAAAAGAATTCGTCGAGATCATTATTCCTTTGGTAGACATGGTAGCCACACCCGAGGA
CAAAATCGTGCCGCTATATAACTGGTCTCACGAAAATCACTCAGGATCGTCACAATATTCCTCGGCAGATTCTGAAATTGACTTGGACGGATCGTTTAGT
ATTAGCCAGATGTACCTAGGACCACCAGGAGGATCTTTTCTAAAAAAAAAAACCGGGGTGTCGGAGTCAAGATCGAGCCGTCATACGAGCAGCTCAAGAC
CGCGATTCAAACGTCACCCGGATTTGCGATGGCCGGATCGAACGGGATCAGATTTGACGACTTGGAGCAACACTTCAATAACGCGATGAAGAAGTTTCTG
ACGGAACAGAAGACAGAGCGGGAGATAAACTGACGTGTAGATCAGGGTGGATCCCACCGACCCTCACCTCGTATGTCGGGACATGCCGGATGTGGACATG
AAATCAGTGGATCGGGTCCACTCCGGCAGAACTTGAAATATGACCCGAACAACTTATGGATATCCAACCAAGAAGACAACAAGTACCCGCGATCGGCGAC
ACAGGTAACAGCGTCAATACGCATAGAATCAGAGTATAGGCGATCTCGGAGTTGAAAGAGTTCTCAGGAAAAGATCAGGATGAAGATCGAGTGCGGGTCT
GGATCGACAAGACTAAGTCGGCGTTCCTCCGGGACCAAGCCCCAAGATGATGAGAAGTGTTTGGTGTTTGGCGATCG