Description :
From Genome Similarity Track
Location :
Scaffold_48:94787- 99630
Transcript NameFunction/comments
Phymu_g2635hypothetical protein PHYSODRAFT_534506
Phymu_g2636hypothetical protein PHYSODRAFT_534417
Phymu_g2637hypothetical protein PHYSODRAFT_534444
Phymu_g2638presenilin-like protein

Sequence
4843 bases(100 bases per row)
AAAGTAATAACTAGCAGTACCAGTAAATAAAAAAAGAGTAATTAGCAAAagaaaacaacaacaaaaaagCAATAATTATCGCCGTACTGAAGGCTTGAGC
CTTGCAGATTGGAGTCACGGCTTCTCCTGCGTCCTGATCGAATGTTTCCGTCGGTAGCACGCCGAAAGCTCGGCCTGTAGCGCCGAAAAGGTCCTGTCAA
AATTCAACTACTTTGTCAATAATAGTTTTTAAAAGCACAAAATGTCGAAAATGGATTTTGGACAGACCAGGTACGCGATAATATGGATGAGCTCCTTGGT
GACGTCGAGGTGATGGGCCGACGCGGCGTAGAGCGACAGGGACTTGGCCTTGAGGCGACGCGCGTACCAGTATCGGCCGATGATGTAGAAGGCGCCGATG
ATGGAGAGCACGGAGGTCGTGGCCGACGCCACCGTCTGGTAGTGCTGGTGGCGCGCCTCCTCCGCGGACGTTGGCGTGCCCATGACGCCTAGCAGCAACT
CAAGAAGTGCTGGGGCTCAATTGGGAAGTGACTGGGGTTCTAAAACCCTTGAGAAGTGCAACCCTATTGTCAGGAAGTTGATACCGATCATTGATATACA
TTTGTGAAGGTATACTGTAGCTAAAAGGTATTGATGGGAGACAGTGGATTTATGAAAGGATAAAATAATAGAGGTTATGTATCATTGAGAAAGTGACATG
GATTGGTTAAAGAAACAGTGACACACGGACGTCGGGACGCGTAGAAAAGCGACGGTCTCAGCAAACGTCCCACTTTCGATTGGCGACCTACATGCAAGGG
CAACTTGGCCCTTTGCAGCTGAAATTCCATGTGAGATGTCGCCCAGCCTGGTCGTCGTATGGCGAAGGTCCGATGTTTCCCAGCGTCGAAATGCGAGACA
GTTTACCGCGgttgcagcaactggcaTCGCCTCTTTAGCTGTGACTCACAGTGTGAGTCGGATTGAagcttgaagctggtgtCCGCGGACCGTCTTCGTG
CAGGGCTTGCACCAAATCGAGAGCCACATCACAGCCTCAAACCGGTGGTGGGTCTCTACACTGGAGACGCCTCGACGCAGCATTTGGCCGGAGCTCGGCA
GCAAAGTGTTCTTCAGGTCGTGGCAAGGATGGAGATCGTGAttttactacatgtagcgttAGTCATGAATTACCATCACTTTTGCTGCCGAGGCTTAGAA
CCTCAAAACTGTCAAATTGACTATTTTGACAGGACATCCTGTTTGTCAGTTCCAGTCTACTTTTGTAGCTTTTTTTTCctttcagccaatcatatGTCGA
CATCTGAAACGACGCGGATACTTTTCCAGCATTATCGATCCGCTAGACCTACGCCaacgccttcctcttcctcccTGTCGCCATGGACACGACGGACGCG
CCGCAGCTCATCGAGCACGTGAACCAGAGCGTCAACTTCACGCCCAACGACACCAAGTGGATCCCGGGCTCTGCGCGCTTCGTAGCCATGGGAATTTACC
CCAAAGCCACAGGAGCATTGACAATCTACGGCCTCAACCAGGGAGAGCTCAAGACACACGCGGTGCACGAAAAGCCGCAAGGGATTAAGTGCGGGACCTT
TGGGGCTTCGGCTCTGGAGGACCGTCACTTGGCTACGGGCGACTACGGCGGCGTCATGAGCGTCTGGTGAGCACTCGCTCCAAATTTGCAGGAATTGGTT
TAAAACTGGAGTAAATAATGATTTTAATGCTGTTGACAGGGATCTGGAGAAGGCTGACGTGCCCGTGTACTCAGCTCAAGCCCACAAGTCCATTGTGAAC
GCTATTGACGGCTGTGGGGGGCAGAATATCGGCAGTGGGGCGCCAGAGATTGTCACGGGCGGTCGGGACGGCTGCATCCGCGTCTGGGACGTGCGCGTGC
CCGATCCAGTGGTGACTTTAGCACCGAAAGAACAGGACACAGCGAGGGACTGCTGGACGGTCTGCTTCGGCAACTCGTACAACGACGTGGAGCGTTGCGT
CGTGGGGGGTTACGACAACGGAGACATCAAGATGTTTGACTTGCGCACCAACTCGCTCCGGTGGGAGACCAACTGCCAGAACGGCGTCGTCAACGTGCAG
TTCGACCGCAAAGACATCGAGATGAACAAGCTCCTGGTCACCACGCTCGAGTCCAAGTTCCGCGTCTATGACCTGCGCACGTTCCACCCAGAGCAAGGCT
TCGCGTGTatgacggagaaggcgcacAAGTCGACGATCTGGCAGGGCCGCTTCTTGCCTCAGAACCGAGACCTGTTCATGACAGGTGGAGGTAACGGTGG
CTTCAATCTGTACAAATAGTACGTGGTCCTGTGTTCTGTGTGCTGCGTAGCATTGATCTAACGCTTCATGTTCTGTTTCTGTAGCCACTACCCACTCTCA
AGAACAGCCAAGGACTCGGACGGTCGACTCTACGGCGTTTGTGGCacagtggagctgctcaactcTCGAGTGCTGTCCACACAGCCGATTGTCAGCATGG
ACTGGAGGTGGGAAAACCTGATTGAGATGGTACTTGTGCTTGCGTTCGTACTAAACTTACGATTTTAATGGTATCCAGTCCGGATCGCGAGGGCCTTTGC
ACTTTGGCGTGCTTAGATCAGACAGTTCGCGTCTACATCGTCACAAAAACGAACAAGTACTAGGCAGAGACACCAACAGTTCAATCTCATACAAAGGATT
AGCTTTACTCCACTGCTACAAGTCCTGCTGGGTTCGCGTTCGCGTTGGAGGTGAGTGATTTGAAGCCGAGAGCGCGAAtctcctcttctgggatgcCAAA
CTGCGTCAGTTTCTCCGTGAAGGTGCGCAGACTGTCGTTGTACGCTTTGCTCTCCTTGGCCACGCTGTACTGCAGCTTGCGGATCTTAGAGTTCTTGGAG
TCCAACAGCGTTcccagcgtctccgtcactCGTCGTGCTTGCACCGGATCCAAGTTCGCAGCCAGCAAAATCTCCTGCAACTGAGCCCCTTTCCGTGCGT
GCTGGTCGTCCATCGACGACAGACGCTGCTCCAGTATGAGGTTCTTGCACTCGCCCTTCTTGTGGATGGTCTGCACTGTGTGTTCGAACGTGTCGTACAG
CGCGTTGCGGTCCGACTCCATGGTGCGGTATTTGACCGTCAGGTCGGTTTGGCGCTGCTTGAGGTCGTGCACCTGCTGAGCGAGATACAGCAGCCTCGCC
TTGGCGTTCCGTAGCGACAGCTTATCCTTCTgttcgtccttgagctcgtgtcgtaagtgctccacctcctggATCGCAGCCGCTAGCGGTTCTGACAGTC
GCTTGTTCTCTTGGGAGACGTCGTGCATGAGCTTGGTGTTGGCtgccgctttcttcttcatagCAGCGATCTCACTCTTGAGCGAGTCGATCAGGCGCAG
ATTGTCTTTGGTGATGTCGTTGTAGTAGTTCTTGATCTGCGTAAAAGCCTTCTCGTGGTTCTTCATCAGGTCGTTGATGTGCAggttcttgcgctcctcg
atctcgtGGATGTCCACTTTgcgacgcagctccagcgattCGTGCAGGTCTTGTAGACGCTGCTGGCAACGGCCTTCGAGCGCCGcgttgttcttctcga
actgctcgcgcagcttcatgaggttcttctcgtgcgcctgcttcatctgctcgatctcgtcttcgttggaCAGATCTcgctccttgagctcgagcttgag
cgaCTGCTTCGTGCTCCTCAGAACGGTCTCCCTGTGCTCGTGCAGGTCtcgctcctcgtccatgTGGCCGGTGCCGTCCGCCTGCACGCGCTTGAGGTTG
TTCTTGTGCTCGTAGTCCAAGTGTTTGACCTTCTGCACGTACACGCGCACTTCCACGCGGTGGTTGTCCTCCatgatctccatctcgcggTCTTTGGACA
TGATCTGGTTCTCGTGGTCCTGGATCTCTTGCTTGGTGATCTCGTAGAACGATTCGATCATATCCTGAGTAGCAAACAGGTTAGATAATTGTAGACTTTC
AGTGTTTAAATCCTTCTATAGCGAACccgttcgtgctgcacgtaGTTGCGATCCACttgcgccttctccagttgctgccTCAGCATCTGAATCACCTCCT
TGAGCATCGGCACGTCCATCGTGTCATACTCAGAAGGTTCTTCCGGCGGAGgttcctcctctttcttgcctttcttgcccttcttccctttcttcttggg
ccCCATGGTGCTCTACGTGTAGCttcttgtgtgtgtgttgAAAGCTTCAACTGGCTTTGAGCTAGGGCGTTACATCAACGTTAAAACAACCGCAAAAAGT
GACCCTCGCCTCTCTGCTTGACAAGGATCCATCCTCCCGTCCCTTCGATAGATTTCTACCATTCATGGGGAATGCAAGGTCCGGTACAAGGAGCTTGGCG
AGTGTGCACTACCTGgacgacaacagctcgacGATGTATGAGCAGCCGTTGCTGGACAGGAgagagaaggagcagcaagtgcaggagcagagcgagcagG
TCGACTTCGGAGTGGTGATTCACCAACTGAACAGTTTCTTCGCAGTGGTTTGGCCCGTGTCCATAGCGATCATCAGCTCGAGTCTCGCAGCCTCATACAT
CTCCGACCCGGTAACGAAGCGAGCCATGacgacgtacatgtactaccaGGACATCGACACGTCCGAGCTGTCGACAGCGGAGAAGACAGAGGAGGCATTC
TTCAATGCTCTGCTGGTGATTAtcttcatcgccttcctTACATTCGGCatcgtgctgctgtacaAGTGCAACGGCATGCATCTCTTCGCCTGGTACTGTA
TGTTGTACTCCGCTGCGCTGCTCGGGCTCATGGGCTCcaaact