Description :
From Genome Similarity Track
Location :
contig_229:9478- 10851
Transcript NameFunction/comments
g14893.t1hypothetical protein

Sequence
1373 bases(100 bases per row)
AGCTCCCGATTTTTTAGCTGCTGGATCGTATTGCTCAGCAGGGAGCGGCTTGGGCCACGAGCGAGACCTGGATCTGGATCTACGTGGGCGCTTGTTTCCA
CTTAGAGAAGGACCAAATCGACTCCCGTCTCTGGACCATGGCGATACGGCTGGAGGTGGGCCACGATCGTATCTCGAGGACCGATTACCATTTTTCAACG
CAAGAAGACGATCTCGTTGCCGTAATGGGGTACTACGTGCACTCCCATTTTGCGATGAAAGAGGAGACGGTCTCGGTGCATTGCGGTCGCTTGAACAAGA
TCGCCTCGGGGTGCTTTGGAACCTCATATCTGCAGCAGGGGAAGAGCATGGGCTGATACTCACGCCCGCCTTATACTCCGTTTTCAACTCTAAAGGTCCC
CCAAAGTCATCCCGGAAGACTTGTGACGCCTGCTTGGCGTCCTCGCGATTGTAGAAGTGCAAATATACCGTACCAGATTGATTCTTCATCAGTCTCTGCC
AGTTTTCGCGTGGGATATCGCAGCGCGGCACGGATTTGTTGATTGTATAGCGCTTCACCAGCGAGGCAGCAAACTCCTCGCGGTCACGATCCTGATTAAA
TCGGATGCCGGTGGACCTCCGCTCAAAACGCGCGTTGCGAATAATCACCGTTATCCATCCACGTAATGACTGCGGTACGAACGCGGTCCCGTACATTCGT
TGTTGGTAAAACTCTCTGTCCTTAGGGCGCTCGAAACGCAGCTTTTCATAGCAGTTAATTTCGCGAGTCTTCGGTTCGTCGCTGATGTATTCATCAGAGT
CGGGGTTTGCTTTTTCTTTAGACTTTGGGGCAGAAAGTGATACACCAAAGAACGAAGCGGCGTAAGATTCCCGATTCAACGCAATTTCAGGCTTCGTAGC
GCAGCTCAAGCGAGGGATCAAATCAGGCAGTACTTCTCCATGGACGTCGAAAACCTCATACCCAATCGTGGATGGTGCTGATGCCTTATTAGATTGAACC
GCCAGCTCTGTTATTGCCATGAAGATCGAGTTACGCCTCTTGGACAGGCGCATCATGGCTCGATCTTGCTTAGAAATCGCCATAGGCTTCACTGGCACAT
GGTTCTTCGTCCGCTTTCGTCGGGGGCGTATAGGGTCAGGCTTTGACAACTGCGGGCTCGATTCAGGAGACGGCAGTGGTTTCAATACGACGGGAACACG
GGACTGTAAAAAGCGCTTGGTACCACCCATGTTCACTTGCCCCCGAGGTGCCTCTTTCTGACTCCCTGGTTTTGCAAAAGATCGCTTCGGGATCACAAAT
TCCGAAGCATTTGCAATCGTGGCTGATCCATTTTCAGCAGTTTTCCTTGGGATTGGGATCGCGTCGGGCAGTA