Description :
From Genome Similarity Track
Location :
Scaffold_62:94763- 97397
Sequence
2634 bases(100 bases per row)
GCGCAAGATGGACCCCAAAGCGCGTGAAGCCATTTTTGTTGGATACAGTCGTGAAAAGCGAGGGTATCGTCTGCTGGACAGCAAGACCCGAAAAGCTTTC
TACAGTCATACGGTTGTGTTCTTTGAGAATAAGGCAGGCGGAATCCTATCGGGATCGTCTACCCCGATGCCCAGTAGTGTGTCCACTCGACAATACCTCG
AGGTTGAAAATACTACAATGGAGAGCATACCAGCGATGCTGGATGAGATGTATGAGGAGATGCATGATGATGCTCCTGCAACCAACAACTCCAACCAGAA
CCTGGCAGGTGGGGCAATTGAAGGAAGTACCAGGACTGGTGGGGCTGTTGGAGGACACACAGGAAAGAGAAAACGAAGCACTGTGAGTGCAGGCGGCAAT
GAAGCTCGAACGAAGCGAGTAAGGTTCGACGATGAGCCTTCAGTGCGACGCACTGAACATGTTGCAGTGCGCGGCACTGAGCAACAGCTTGCACACGTCC
GAAGTGACGGTGCTACCGACTCAACTTGCCGAGGCAAGCACAAAAGCAAGCGAAAACGGCAGCGTGGCCGACGCAAAGGCTGTTACTGAGTCTCAAACTG
CCGAGTCAGGGCAAGAAACGGCACGTAGTGGCTTGCCGACCATGGAGAGGCCTTCTTCTCTGGAGAATCGTGCGATCGAGACCGCGAACTCTGAGATGCT
GCGACCAAGTGACGACTCTAGCACAGAGAGTATAACAACCTCTAGATGCAGAGCGTTGCGAGAGTATGTGGCTCCAGAAGGTGTTCACACAAAGGACTAC
CCAGTAACACGGAGTGGTCGTGTGAGCAAGCCGCCTCCATGGTATGGTGATTCCATCTATGTGGCATATCTGCATACCAATGAAGACTGTGAAAATGAGT
CTCCAACATGGAAAAGGGCTCGAGAAGAAATGCAGAGAGAGATGGCAAAGGAACAAGCTTGTGCATGGTGGCAAGACTATTGTTGTCTCACCATGAGTGC
CATACAAGAGCCTGAAACGTTTGAAGAGGCAATGCAGGGTCAGTTTTCCATGCAGTGGAAAAGTGCGGCTCAGAAAGAGTATGATACTCTAATGAAAAAC
TGTACGTGGAAGTTGGTTCCACGAGGCAGCAACATGAACGTGTTGCGAAATCGGTGGGTGTTCCGCGTGAAATACCTTGCAAACGACGAGATTGATAGAT
TCAAAGCGAGATTAGTGATCAAAGGCTTCATGTAAGTCTATGGAGTCGACTATCTTGAAGTGTACTCACCGGTGGTGCGATTGGAGACACTGCGGGTTCT
GTTAACCCTTGCAGCTGTGTGGGACTATGAGGTTCATCAAATGAACGTTACAACTGCCTTTCTGAATGGCAAGATCGATATGAAGGTATTTATGGAGCAA
CCAGAGGGATTTAAGGTGCCTGGTAAAGAGAACTGGGTGTGTTGCTTGCTAAAAAGCTTGTATGGCTTGAAGCAAGCACCACGTGTGTGGTTTCAATTAC
TGAGATCCTTTCTGGAGGAGCAAGGCTTTTCGTTGCTGAAGTCGGAGACATCTGTTGCTGTCAAGGTCATTGATGGGCAACTAGTATTCATTCCGTTGTA
CGTGGATGATCTGATCCTATTTGCTCCTAACATTAAACTTATCAACGAGATGAAAGAAATGTTTCGTAAGCGATTTGAGATGAAGGATCTGGGAGAATTG
CACTATATCCTGGGCTGGGAAGTTACACGCAATCGCAGTGAACGAAAGATTTTCATTAGTCAGCACAAGTATGCTATGACAGTGTTGGAGAGATTTGGAA
TGGAACACTGCAATGGGTGTAAGATGCCATGTACCCCAGACTTGAAGTTGACAAAGAGCATGTGTGCTGCAGATGCAGATGAAAGAACTCTGATGAAATC
TAAGCCGTATCGATCAGTAGTAGGAAGTCTGATGTACCTAATGATGGGCTCACGTCCTGACTTAGCGTATTTGGTCAGAGAATGCAGTCAATTTCTCGAG
AACCCAGGAATACTTCATTGGCGAGCAGCTAAGCGAGGACTACGGTATCTTCGAGAGACTGCTGAATGGGGTATTTGTCTCGGTGGAAAAGAATGGATTG
ACCAGGAACTGGATCAACATCTACAAGCATTTGTTGATGCTGATTTTGCTAATCGAGTTGATGACAGGAAATCTATTGCAGGATACTTAACGAAATTCTG
TGGAAGTGTGATCTCATGGAGCAGTCAAACGGAGAAAACCGTGGCGCTACATACAACTGAAGCCGAGTATATGGCTTTGAGTCTACTTGTGCAAGAAGTA
GTGCATCTTCGTCAAATGCTGAAAGAGCTGTACGTACAACAAAAAGCACCAACGGACATCTTTGTGGATAACGAAAATGCAAAGAAGCTAGCAAACAATC
CAGAGTTTCACAGCCGCACAAAGCACATTGATGTGCGCCATCACTTCATTCGTGAACGTGTCAGCATGAACGAGATTACTGTATTGAGAGTTGCAGGTGT
TGACAATGTGGCAGATGCTTTCACGAAGCCGCTACCAAGGCCAGCATTCGAGAAACACAGAGAAGTCATGGGGCTTATGTCCAAGGAGCAGTTTGAAAAG
CCAAGGATATCAACGACCAGTAGGTGGGGCTGTT