Description :
From Genome Similarity Track
Location :
Scaffold_849:9472- 11389
Transcript NameFunction/comments
Phyin_T30-4PITG_21929Putative uncharacterized protein

Sequence
1917 bases(100 bases per row)
AGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGT
ACGCCCCGCCTCCGCGTCGAACACGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCG
TTTAGGCTCTTTCTTAGGAGCGACCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTT
TCGAACATTTCACAATCTGCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGT
AGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCG
TAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGATGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGC
TGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTTCTCAGTTCCACGAATGCGTGTTGAGC
TCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCACCGTTGGTCCCGGGGTGGATCCAGCTCCTGT
TTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGTGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGG
TCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAA
GGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCT
AAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACA
ACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTACAGGATCCCCTGGCTCTCCTGCCTCAAAT
GGATCTACTTCCGTATGATCTTCCCCGGATACACCCCTTTCGGGCTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCT
GGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAAC
TACCCAAAAACCGCTGGCCATGTCAAGAGCGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAAT
CGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACAGGGACGTTG
AGAAACTGATGATCTTGGATTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTT
CGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGA
CGCAGACGATCCACTTC