Description :
From Genome Similarity Track
Location :
Scaffold_1262:9472- 10776
Transcript NameFunction/comments
Phyta_totarag12552hypothetical protein

Sequence
1304 bases(100 bases per row)
CAGGATAATCCCTGGTCAAAACCTGGATGTACCTTGGTGAGATAGTCGAGAATGGAATTATGAACGGGTTGTCACACATATTCCTGTACACCATCGCGTG
TCGACACGGAAGCTTCATTGTCTGTGAGAACTCACagtcacacacacacaccctCCTTATCGAGAAGGTACTCGTGCTCCCCGCGTTGGACCGTGATCGT
AGTGTCGTTGTTATTGAACGCGTAGCTGTCAGCAATCGTGGTGTCTGCAGCGATATGCTACTGAGTCTTGATCGCTGCGGCCACGCAATGAGTCGTTATC
CCCAGAGCAACATTCATTTCCTCTGGGTACGAGACGTCTCGCAACGTACCCGGCATCTCCACCTTGGCTCTGtattcttcttcttctttgtgTCGCTGAT
AGTTCAAGATGACCCGTAAGCTAGCTTACATCGTTAGATGCCCCTTCAGGTAGCGTTTCAGCTTGCCGAATAAGCTCTCAACACGGTTGTTCGTGTGGTT
GCCAAAGTGGGGCAAATCAACACGATACGTCATTACCCATATCTCACAACAAGCGTTCAAATTCTTATGAAAGTACTGCCATAGATCTGTACGATCGTCT
CAGCAAGCGAGACTCTTGAACTCATCTCGATGCATGCATAGTCCTCCCAGGTCCTTGAATATGTCATAATCATAATGGTATGCTTCATCTGTGTCAGGAC
ATCTTCTTCGTAGACGCCGTACGCTCTCGACTTTCGGGTcgtctcgtgcagccacttgatgACGTGAAACTGATAGAGTAGCACTCGGGCCTCTGGAAGC
TTCTTGCGGATGACTTCGACCTCGCGCATATTCGTGTCGACAATTACTATCCGCACAAAAAAAGGCAAGTGCTCATTCACTCGCTTGAAGTGAAGCAAAC
ACTTCGCCATGTACCAGTTACCATTCGTCTCGATAAGAGAGTACTGTATTGGCTGTCCCTGCCCATACTGATCCATTGTGACCATTGTGAGAAGCTGATA
GTTGTACATAAACACACAAACAACCCATACATGGTTAAACTTGCTGAAACCTGTCCCCATCCAACGTCAGTCATAACCCACTGGTTTGTCTGGTGCGTGC
AATCTATTTGCAGCACCTCTGGATAGCTATCGAACATCGCACGCATGTGGCCACTCATGAACGAAATGTGTCTCCACGCGCGCTTTCGTGCACTGATTTA
ACATTCATAGACGACTCTTGATTGAAGTCCACGATCATCTCAGCAagttcatcatcatcagaCAGCTCCACGCCTACGCAAACAACCCACATAAACACCA
GTAT