Description :
From Genome Similarity Track
Location :
contig_43:94715- 95981
Transcript NameFunction/comments
g6325.t1hypothetical protein

Sequence
1266 bases(100 bases per row)
TATACGCTTACTCGACGTACAGCACCTTCAGCAGGTTCGTCGAGCCGGACCTAGCCTCCGTGATGCCGTGCACGGCCACAACAGCGTCGCCGGTCTTCAG
CCAGCCGAGCTCCTTGCCAGTCTCCGTGGCGCGGTACAGGATCGAGTCCGTGCCGATCATCGAGCCCACGCAGCGAGACACAACACCCTTCACAAAGCCC
TCCGTCTGGCGAGCAGTCTGCTCCAGAGCCGTCAGCACCAGCACCGGCATCTGCGGACGGTACTTGGCAACCAGACGAGCAGTGTTGCCCGTCTCCGTCA
GCACCACCAGCATCTTGGCGTTGATGTCGATGGCCGTCTTCACCGCCGACGACGCAACGGCCTCCGCCGTCTGCATCGGGCCGTTCACCTCCAGCACAGC
GTTGCGCAGCGACTGGTACACGTCGTTGTAGTGGATGGCGGTCTCAGCCTGCAGGCACGTCGCGGCCATCACCTCCACAGCCTGGCGGGTAGTCGCCGTT
GGCGCTCTCACCCGAAAGCATCACGGCGTCCGTGCCGTCCAGCACGGCGTTGGCCACGTCCGTGCACTCGGCGCGGGTCGGGCGGGGAGCCGTGATCATC
GACTCCAGCATCTGCGTGGCCGTCACCACCGGCTTGCCGGCCAGGTTCGCCTTGCGGATCATCATCTTCTGCGCGAGGAACACCGTCTCGGGAGGGATCT
CCATGCCCAGGTCACCACGGGCGACCATGATGCCGTCCGTCTTCTCTAGGATCTCGTCGAAGTTCTCCATGCCCTCGTGCGACTCGATCTTCGAGATGAT
CTTGATGCCGCGGCCACGGGGGCCCAGCACCTTGCGGATGTTGTCGAGGTCTTGGCCCGTGCGCACAACGAAGCGGCAATGTAGTCGATGCACGTGCACC
AGACCGAAGTTGATGAGGTCGTCCTCGTCCTTCTCCGTCAGCGTCGGCAGCAGCACCTTGCAGCCGGGAAGGTTCATGTTCTTGCGCTCGCCCAGGGTGG
CAGTGTTGTTGGCACGGCACACAATACCCGTGTCCTTGATCTCCGTGACGGTGAGGACCAGCGAGCCGTCGGCAACGAGCACCGAGCCGCCAACCTGCAC
GGACTGCGGCAGCTGCGGGTACGAGCACGCGATCTTGGTCTCGTCACCGAGGAACTCGTAGTCCGTGGTCAGCTCGATGAGCGCGTCCTTCTCGATCGTC
ACCTTGCTCTTGTTGGGCAAGGAAACCCGTACGGATCTCGGGGCCCTTCGTGTCCAGCATGATGGC