Description :
From Genome Similarity Track
Location :
scaffold_228:9470- 10843
Sequence
1373 bases(100 bases per row)
AGCTCCCGATTTTTTAGCTGCTGGATCGTATTGCTCAGCAGGGAGCGGCTTGGGCCACGAGCGAGACCTGGATCTGGATCTACGTGGGCGCTTGTTTCCA
CTTAGAGAAGGACCAAATCGACTCCCGTCTCTGGACCATGGCGATACGGCTGGAGGTGGGCCACGATCGTATCTCGAGGACCGATTACCATTTTTCAACG
CAAGAAGACGATCTCGTTGCCGTAATGGGGTACTACGTGCGCTCCCATTTTGCGATGAAAGAGGAGACGGTCTCGGTGCATTGCGGTCGCTTGAACAAGA
TCGCCTCGGGGTGCTTTGGAACCTCATATCTGCAGCAGGGGAAGAGCATGGGCTGATACTCACGCCCGCCTTATACTCCGTTTTCAACTCTAAAGGTCCC
CCAAAGTCATCCCGGAAGACTTGTGACGCCTGCTTGGCGTCCTCGCGATTGTAGAAGTGCAAATATACCGTACCAGATTGATTCTTCATCAGTCTCTGCC
AGTTTTCGCGTGGGATATCGCAGCGCGGCACGGATTTGTTGATTGTATAGCGCTTCACCAGCGAGGCAGCAAACTCCTCGCGGTCGCGATCCTGATTAAA
TCGGATGCCGGTGGACCTCCGCTCAAAACGCGCGTTGCGAATAATCACCGTTATCCATCCACGTAATGACTGCGGTACGAACGCGGTCCCGTACATTCGT
TGTTGGTAAAACTCTCTGTCCTTAGGGCGCTCGAAACGCAGCTTTTCATAGCAGTTAATTTCGCGAGTCTTCGGTTCGTCGCTGATGTATTCATCAGAGT
CGGGGTTTGCTTTTTCTTTAGACTTTGGGGCAGAAAGTGATACACCAAAGAACGAAGCGGCGTAAGATTCCCGATTCAACGCAATTTCAGGCTTCGTAGC
GCAGCTCAAGCGAGGGATCAAATCAGGCAGTACTTCTCCATGGACGTCGAAAACCTCATACCCAATCGTGGATGGTGCTGATGCCTTATTAGATTGAACC
GCCAGCTCTGTTATTGCCATGAAGATCGAGTTACGCCTCTTGGACAGGCGCATCATGGCTCGATCTTGCTTAGAAATCGCCATAGGCTTCACTGGCACAT
GGTTCTTCGTCCGCTTTCGTCGGGGGCGTATAGGGTCAGGCTTTGACAACTGCGGGCTCGATTCAGGAGACGGCAGTGGTTTCAATACGACGGGAACACG
GGACTGTAAAAAGCGCTTGGTACCACCCATGTTCACTTGCCCCCGAGGTGCCTCTTTCTGACTCCCTGGTTTTGCAAAAGATCGCTTCGGGATCACAAAT
TCCGAAGCATTTGCAATCGTGGCTGATCCATTTTCAGCAGTTTTCCTTGGGATTGGGATCGCGTCGGGCAGTA