Description :
From Genome Similarity Track
Location :
Scaffold_174:947- 2982
Sequence
2035 bases(100 bases per row)
CCTGAGAGTCGACCTGGTAGGTGGTGGATTCATACGCCAGAATCATACACTTAGCGTAACTTTGAGATCCCACCGAGACGAAACTTGTGCTATTGGTACT
TAATCGTTCATCAGCCACATAACTGTCTTGGTACTGTTATGTAGTATTAACGTGTATGAACTGACGTTGGTACCTTCAGCAGTTGTCGGCGTCCTATCCC
CCGGGTCATACTTGTAACCCATCAATCTCCTCTTGTTACCCATATCTTCCATTGCTCTGTGGTCGAGTTTTTTAAGGTATCTACACACACACCAGCAAGT
ATAAGCGCATATTGTCCCAACCTGAATTCTGAAACTCGGTTATCGTAGACGGGCCTCCATCCGGAGAGTTTAACTTGAACTTCGTTAGGAGACAAAGTGT
TCCGTCCGCCAGGTCTAGCCGGATACCATCCGGAATCATGAAGTCCATTCCTAAGATCTCATCGTGACCCACCATGGAACATACTTACGGATTAAATACT
TACACTAAATTTCCATTCAGGGTGACTTTGATGCGAGTGCGCTCTTCCGTAGAGTATACTTATTCCCCAATGCCAATGCACTCTTGTCGTTCAGTTTCGT
CGATTTGGCAGCCTACCTTACGAGCAAAGGCGATATTTAAAACAACAAATTTGCACGATCGTTGTTAATCTTCCCTTTGGCTTGTTTAAACCACTTAGTG
GATGCACGGTATGTCCAGTAACCTCTGCATTCGCCGGGAGGTAGGTCTAACTCCATCACTGCATTATCTCGGGCAAATCTTTAGGTTCATTGAGAGAGAC
AACATGGACCACAGAGTATTTTTTATCTTCGATGTATTATCGATCTTCTCAGTGAAGAAATTCCTCTTGGGATGCTTTTCCACATATGCAAAATCTAGAG
CGCTCGGATCGTACCAGATTCAAACCTGGCGAGCGTTCTAACTTATCATCTTCTCAGCCTTCTCCGTCAACATTCCGGCGTGCTTGATGGGGTTGTACCA
TTGGCATATCAAGTTATAAAAGTCCTCAAACTGGTACTTTCACGCTTCATGGGTCTCTCCGCGTCCTCGGCACACAAATAAGTAGCGATATGATGGTTAA
ACCTTCTTCTTGCAGCGGCCACAGGTCATTTCCTTCATGCATATCAAGTCTACATGTTTTCTGGATCCGCAATTGTCACAGCCCACGTTTGACTCGGCCG
ACCTATTGCGGGGTCCCGGGTACATCGCTTGTTTCCGATGCTGGTCGACCTTTCCGGTGGTTCATTACCTCATGGTTCTTGAACTTGGGTCCCTTTCCGC
TTCAGTTAAGTAGAACAGTCTTAGGTATTCGTCTTTATCCAAGTTATCCAGGCTGGATACCTCAGAGCTCGACTCTTCCAGAGCCGCTCGGACCGCATGT
ACGGAGCGGCATTTAACTCTCTAACTCATTCAGGAGGGGCGCGCACCTTTTGACATAACTTGATCAAACCAAAAAAGCGTCTTGCCATGTCGTGCCTTCG
TTCTCTGATGCGCCCTCAACATTTTTTAAGTCATTTACATTTTGCGCCCTCAATATATCTTCCAAGTATTCCACAACTAGCATCGTCAATTGGTCCGAAA
ATGCTGGGTCATCTAAGGTCTAGATATAATGCTCCACATGTTCTTTCTGAATCTTGGGCAATCCATTTTATATCATTAACTTCTTCTCGAGTGTAATCAC
ATTTAACAATACATATAGTCAAAGGTGGATTCATCTGAACTCTTCTTCGCGTGGTAGTACGGGCGAGCAACTGGTACCCCAAGACCACAGAACCGCATCT
GATATTTTTGCAGCAGTCTTTCCAAGTTACTCGAACTGAGCGACTTAGTTGGAGGTATGAGTTCTGTGGCGGAGCGTTCAATATCCTCCAAAAAAGATAC
ACTTTTTTCCGTCTGTTGCTTGGTCCCTCGTGAAGACGGTCTTCGAAGTGGCCATCGAACTGCGTACTCGGTCCCCGTCCAGGCATTGTTCATTGAATTT
TTTGAGATCCAAACTCGCTGGGTCCTTGATTCGGG