Description :
From Genome Similarity Track
Location :
Scaffold_3062:947- 2164
Transcript NameFunction/comments
Phypl_g15590hypothetical protein

Sequence
1217 bases(100 bases per row)
ACTCAGGAAGCGTGACCCACGCGATAGGCCTGATTAGGCGGAGCGAACACTCggagagctcgagcttcagctCTTCCCAACCCGGGAAGGCAGCGTCCAC
CGACGTGCCGCACGTGAGTGattctcgcgctcggccaccGAGCTTGGAGATCACTagcgccacgcgctgttGCTCAGTACGGAGCATGGCTGATCCCATC
GCCATCTCGATCTCACGGATCCATAGCATGAGGTTCTCCCCCTCCTTTCCTTCGAAAGTCTTGACGCTCACAATGAGCGGTTTCGGCCGGGAGGCCCCAT
cctgcgctgcagtcgacgccTTCGACAGCACAGCCGCAGTCATCCTCTATTGGAGGTGCTCCAACAGAGCATTGTCATAGTTAGAGAACGCTTCCAGACG
CGTATTCACCGCATCCGAGGCTTGCGCAGCAAGATGCGAGACACCCTCAGGGCCCAATAAAGACATAAGCCTATTAAGCGCGTCTTGCTGGCCCGGGGAC
AAGTTCGAAAACGCTGTCGGTTCCATCCTCACCGAGGAATAGTCCTAAGACTCAAGTGCGGGATTGACTACAAGTGCTACCAGGTGCtgcggggctgcgt
agcgtagtgcaTCAGAGaaagacgtatgactctcgAGTCTTAGCTTGTGCTTCTCCGAGCTCCTAAGTCTCagcagaggcttagatcactctagtataac
taactagagacaacgacggtgaaagacgccACGCGTTGGAGAGAGTCAGTATGGTAATtgtgagcgtgcagcagacgacatgAAAACGCACCATCGGCAA
ATGCAGCTATCTGATTGGTTATAAAGTCCAATTCTATTGATTTAGGTTATAATGTGACAGGCAAAAAACATGTGATGAGCAAAAATATGTCTGCGTTTGT
ATTGTTGTtacacctgcagcgtcgggtATTGCGTGATCGCTTTCTCGAACGCTCCGACAACAGTTTCTGCTGAAATCAACCCCCGAGCAGCTATCGTTCG
GTTAATTAACGCCAAgcgctcctccttggtcGTCTCtttgtcttcatcgtcttccttgcccttcttgctCGCCTTactcttcttggtcttcttgtTTGTG
CTGCCCTTCGTGCAAGTCTTTcccttctgcttcttcattCCCTCCTCGTTGCCTTTCGCCACCTTATCCTTTCCCTGCTTGTCCTtcgcctccttgtcct
tccTCTTCGAAGACTGC