Description :
From Genome Similarity Track
Location :
scaffold_72:9467- 10857
Transcript NameFunction/comments
g2759.t1 myosin-like protein

Sequence
1390 bases(100 bases per row)
AACCCGCGCGAGGCGGACGACATGACGTCGCTCTACTATATCCACGAGGCCGGCGTGCTGCACAACCTGGAGGAACGCTGCAAGCTCGACGGTGGTGACG
GTACCGGCCAGAAGCCCTACACTTTCATGGCCAATGTGCTGATCGCTGTCAACCCGCTGCGCGACCTGCCCAACCCCTCCGTTAGTGAGGTGGTGAACAC
CGCCGGTAGCTCGCCTCACCCGTACTCTATCGCCGAAATGGCCTATCAGCAGATGGTCTACAACTCGGGCACCGACCAACCGACCAATCAGTCGGTCGTC
ATCAGTGGTGAAAGTGGTGCTGGTAAGACTGAGTCGTCCAAGATCGTTCTTCGTCACTTGACCACGCGCGGTCTGTACGGCAAGAAGGCGCGCGGAGATG
AGATCGAGACCATGTCCAAGAACCGTCAGCAGCACGGCACATCGCTGGACCACCGACTGATCGAGCAGAACCCCATCCTGGAAGCCTTTGGTAATGCCAA
GACGCTGCGTAACTACAACTCGTCGCGTTTCGGCAAGTTCATGAAGCTGCAGTTCACGGCGGACGGTGAATTCAAGCTGGCGGGTGCTCTTGTGGAGACG
TACTTGCTGGAAAAGTCACGTCTCGTGTACCAGGTGGACGGTGAACGCAACTTCCACATTTTCTATCAGTTGCTGGCCGGCGCCTCGCCTGCTGCGCGCC
AGGAGTTCGAGCTTACGAAGGCGGAGGACTTCTGCTACCTGAACCAGAGCGGATGCTACATTGCCGAAGAAACGGACGACCACGCGTGCTTCGAAGCTGT
GGTGCGCGGTCTGAGCTGCGTGGGTATCGATGACCAGGTCCAGCACGTGATCTTCTCGGTGGTCGCGGGTCTCCTGCATCTCGGTAACGTTGAGTTTGAT
GAAGAAGATACACCCGAGGGCGAGGCTGCCGTTATTGAAAAGGATTCCGCTAAGCGCGCTATTGTTGCGGCGGCTAGACTTCTCGGTGTCAAGGAACAGG
ACCTGTGGAAGGTGATCATGACGCGCGACATTGTGACGCGCGAGGAGACGTACACTGTTCGTCGTAACGAGCAGGCTGCTGTGTACGCTCGTGACGCCAT
TGCGAAGGCCCTGTACAGCCGCATGTTCGACTGGGTCATTAAGCAGGTGAACTCGTCCCTGGGCCACGACCCCAACCCTCTGCCATACATTGGTGTGCTC
GATATCTTCGGTTTCGAGTCGTTCCAGCGCAATGACTTCGAGCAGCTGTTGATCAACTACACGAACGAAGTGCTTCAGGCGACCTTCAACAACCAAGTGT
TCATTGCTGAAATGGAGCTTTACAAGCGCGAGGGTATTACGGTTGGCAGAATTAAGTGGCCTGACAACCGAGAGTGTGTGGATCTGATTG