Description :
From Genome Similarity Track
Location :
Scaffold_314:9466- 15898
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_314-abinit-gene-0.23Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_314-snap-gene-0.9Drug/Metabolite Transporter (DMT) Superfamily

Sequence
6432 bases(100 bases per row)
GACAACGCTGTCCTACGAAGCGCCGCTGTCGTGGGAGCTCGCGCAGGGTTCGGCGATTGACCGGACCGTCCGTGTGAGCGCCGATGCGCAGCGCATCTAC
GCACAGCAGGAGGCGATTCTCCCCACGCTCCACCACGACCACGCGATCAACCCCGTGGCCACCGAGCACCTGCACGACATCGGGCGACGCGTGCTCATCC
TGCGCGAACACACCAAGAAGCCCGACAAGAAGCAGCAAAAGCTGCTCGAGAAGACTGCGCCCAAGCGCGTTATCCACAGCCGCTTTGGTGAAGAAGACGA
GGATGACGATGGCGATGGGGACGGTGACGATGAGGACCCAGCGATCCTGGATGGACGACTGGTACGTGCAGTCGAATGGGACCGTGTTGAGCCTTTATAT
TATGTATTGCTGATCTCTCTCTTGTGGCTGCTTAATAGGCAACAATGCTCCTAGACCAAGAATGGGACACCCGAACGTGGAACAAAGCCAAGGTCCAGGG
GGCGATCGAGACGCTCTACAGCGAGATCGAGCACTCGGACGACGAGAAGCGAAGGGAGCTGGCCACCACCATGCTCATTCGCCTCCTGGAGACCCACGAA
GACGCCGTGGACTTTGTCGAGACGACCATCCCCGTGCTCATGAACAAGGCATTCCGCAACCTGTCCAAACTCACGAACCGCGTCAAGATCTTCCGCGCTG
CCCGGCTTCTCGCGGTGCTCTCCGAGTGGTTCACGCCATTGCTGTCGAGCGAGAATGCGGTATGTGGACATGGCACTAGCATTCCGTATAGGGCTGTCCA
TATATCTAATCATCTCTTCTCTACGTGTAGGCAGGCAAGAGCATCCGCTGTCTGCTTCGGGAGACGGAGATCTGCGCGCGCATCGTACAGCATCACTGGC
GCGGCGTCGTCTTTGAGCGCGGGCTACTGAAGAAGGACTACGATCCAGGTGTGTGCGCTCGACTGCGGGCAATGCACATGGTCAAGCACTTAGAGCTTCA
CCGCCAGTTCAAGGTGCTACGAGAAGCCATCGGCGCCAACGGACTACCCACGAGCGTCGTCGAATCCTATGTCACGGTGCTCTACCACTTGGTAAGAAGA
AAGCAGGACTCGATACTAGACAAGAGCGACACAGAAATGATCAACATGCGACTCGCGGATCAGAAGAAGCTTGTCAGCTCGGGAGCACTCGTGTATCTCG
CGTCGCTGATCACAAAGTGTCAGAAATGTGAAATTGTCGAGATGGTAAAGGCCATCATGCTCGAGATCGCGCTGAGCCAGGGTGACGAGAAGATCGTGGA
TATCCTGGTTTGCAACGTGGTGCACCGCGTCACTGTTGAGATCGAGCGGTTCTTGTTGAAGGACAAGGTCGCGTCATCGCACCCAGCGCTCATGAGCTCG
GTCAACCTGCTGAGCGCTCTCTCGGACGTGCTTCTATCGTCCAAGCGAGCCTGTGGGAGCTCGTCTCCCACGAAAAGCAGAGTCAACGTGCTTACCAAGA
GTCTGAACGACACCAGCGGCGACTCGGAGCACGCATATCTGCGAAGGAGACTGGAAAACAGTGCGAAGAAGCACCTGATCACGCCCTTCGTGGTGCAAAC
CCTGTTCAGCGCGCTTCAGTACGACTCAGTGAACACCAGTCTCTGCATTAAAGTGCTGAGCACGCTGCGGTCGCTTGCTGGGTCTTTCGGGTTCCCTCAG
ATCTTGGAGGCGCTCACACGCAATGGCGGGCGGAACTTCGAGAGCGTCACGTCGCTCTTTGGACACCAGGAGCTCACAGTCGTGTCGGCCGCAGTATCGC
TATTCTACGACCTGACCAATCACCCCGATGCCCGAAAGGGGCTCACGACCGCCGGTGCGACTCAGATCTTCCTCGGGTGGACTGGCTCCGAAGCCATCGA
AAACTCCAAGGCACCAATGTTGCACGTACTGGGCCTCATTGGCGTCGGTCTGCTAGCCAGGCAATCGCACCACGCAGCCTCGTCGTCCACATTGTTGTCG
TCGTTGCAGGCGCTACCAGATCGACTGGACGCGCTCTACGGTATACTATTGGACCTTGTCTCGGACAATAGCCACAACAATATCGAGAAGACAGCCTCGT
ATCTGCTGAATACCCGTGCGCTACCCAGCCTCCTGCGATTTCTGATCCAAGTCAAGCCGAGCTGCATGGACTCGCCTTTCCAGAGCTCAAAGCAGCGCAA
TATCAGTTGTATTGTATTGGGACGGATCCTGAAAGTCCCAGCGGTGGCCCAGTCCTGCTTCTCCGAGGACCTCGTAAACCATTTGGCGCTTTCGCTGCAG
TGCAGTCGACTGGACGAGATCGAGCATCTGGTGGATCGCATGAGCTCAAAGGAGGGGTTTACCCACATCTTGGGCTCGAAAGAGGCGTGCAAGGGGCTCA
GTCGCCTCAGTCGTTGTCCAAGCATGACTGTCAACGCCAAGCTCAAGCCATCAATATCATCAGGGAACGTACCTGAACTACCGCAGGCACTCATCTGTGA
CGTGATGTTCCGTCTTCACGCCTTGGAAGACCTCATCGCCAGCATCAAGAGCCCAAGTGACGGCGCCGAGTTCGTCGGTCTTGAGCTAGAGCTCGTGCTC
GCTGCAGTCGAACTCGGTGGCTACCTGAGGCCACTGCCGTTCGGAGATAGCGCGCGAACCAAGTTCTTCAAGGCCTCGAATTCGGTTCCCCATATTTCAC
AGATGAAGTACGCGAATGATAAATTGTTGGCGCTCGTGGAGCTCGTGGCGCCCGCGATCTTGCATGTGCTGCGTGAAAAGAGCGCCTGCTTTGAGCTAGT
GACCACCTGCTGTACAGCGCTGAGTCGCCTTGCGTGCACACACACGGCATGCAGCCTGCTGCTTCGACAGGGCTGTCTCCAGATTGCTCTGATCCACTTG
CCTGAAATCCTGTTCGCATCGCCAACGTCGCTTAACGAGCAAGGCACAAGGCACCAGACTTACGCCCAGGACTCGACAGTCGACGACCACGGGCTTCTAG
ACGTCCCAGCGTCGCTGTTCACGCTCGTGGGCAAGCTCTGTGCAGTCGCTGAGGGAAGAACAGCGATGATGCGAGCTCAGATACTACCTCGGCTGCTGAA
AAGACTCCAGCTTCGACATCCTGTGGCCTCCAAGAAGAAATCACTCGACGACGACTGCAAGAGCGAGATCGCGGTCGTCGTCCAGCAGCTTGCGATGGTG
AACGCCGTGGAGGGCAACACGAGTGAGCTCTTCCTGCACTTCCACGTGCTCGAGCTCATGCTGCAGCTCGCACAGGAGCAGGACATCGAGGCGATCTTGC
ATGAGAAGAAGGGCAGCCCTCAGAAATGGCGGCTATTGGACCACGCGCTGGGTGCGATCGCAGCTCTCAGCCAGGATGTGCTCGTGTGCGTGCCGAAAGT
CGCCGAGATGGGCATTCTGAAGCTCGTGCTGCCGTTTATCCTGAGAGATCGCAATGACGAAGCGGCGACGCGGGCCGAGTCCCTTCAGTATCATGCTGTG
AGTATCATTCGGTCCGTTGCCGCGTATCCGTTTGGGAAATATCACGGTCTGCTGCAGAGTATCGAGGGCAAGAAGCGAACAACAGGCGGCGCAATAGGAA
ATACCCCCTCTTCACTGCTGAAACGAGTAAAAAAAGTTGCGTACAACTTTGCCCTGGAGCTCGAGAATCGACCAACTTCGTCGCTTGATAAGAAAACTGT
CGGAGAGCTCGCTCGAGAGACGCTGACATTTATTCACGAATGCAGTGAGCGAGCAAACGCAGATCCTCATCCTGGAGCACATAGAACAGTGAACTCAAGA
CGCTCTTCCAGTGGACGAGCGGGTACTCCAGATAGAGTGGCTCGACGCAAGCAGGACTCGCATGACGTGTCGTCGTTCCCAGCTCTCCCAGGGTCTCCAC
TCTCTCAGCACCGAAACGAATCCAGAAGCTCAGACCTGGTGGAAAAACCAGCTGCTCTGGAAAACTCAAACAACCGAAGCAGTGCGGCGGTCTTGTCGTC
GTCTCCTCGTCTCCAGCTCGTCCCCGTCCGATCGAGGTCGTCTCTTCCACCTCAGTCCCCACAGCGCATCCAGTCCCCTTCTTCACAGAAATCATCAGCT
ATCACTGGAGTTGATTTTCTGCTCACGAGACCTCCGGGCAGCAAACCTCAGCCAGAGAAGATGAACAAGTCTGGAAAGCACCACAACCAAGGGATTCAAG
CCAAGAGCTCAACAGCAAGCGACCACCACTCACCAGCAGCTCCGTACGCTTTTGCGGTGCCAAAAAAGAAGGAAAAGACCAGGAACAGCGACATGGCGAG
CTGGAATCTGATGCTCGACCCGCTCTTCCAGTCCAGCGCCGTCAATACTGGTCACCAGGACAACCATCTGAGCGAAAAGAAATCCGGTGCAAAGACCTAC
TCTGGTGGTGGTGGTGACGATGGTTCCCATCAGAGTCCGGCGTCATTCGTCTACGTGCAAGAGATCGATCGGTTCGGCCACTGCGTCAATGTGAAAGCGC
GCCGAGCGACGTCCGGGGACAAGTATGTTCGCTCGCTCGGCCACATTGCCATGAGCACCGGGAAGCAGCAGGAGTGAGAGTTTCATATGGTGAAGTGCCG
CTGAGCAATACGAGTTGTGAAATCTCTTTATTAGTGGGGAGAAGCAATGACTTGGTTCAAGTGTTCTCTATTGAAGAAACGTTCTGCCACCACAGACAAG
CAACACGATGCTGCTGGTGGCGGCGGTCTGGAGACTCGAATCCCTAGACGAGGTCGTGGGCGCGTCTCTCCTCGTCCGAGCGGCGCGTCGTGGTGTCCGT
GCCGTACTTGAGCTTGCCGGCCGAGTCGCGACGAAGCAGCCGCTGGGACGCACCCGCAAGCGGGTTGGGACTCTGGCGATAAAGCAGCTTGCCGCGCTTC
TTTCGCATCAAGTGCGTCTTCTGGAGCGTCGGCGACGTGTACATAGGTGACTTCTCGAACGACTGCGCATCGACCTTGCGCTCCTCCTTCTCCGAGTGGT
ACACGAGCAGCCCCATGACGAGCACAAAGAGCGCAAAACCGTCGTAGATCGTGAACGACTGGCCCGCCGCCTTGCCCGTGAGCACGGGAATCATGTAGAG
CAAGTCCGTGAGCGGGAGGCCGACCGCGGACGACACGACGAAGAGCACGCTGCTGCCTTCCTTGAAGATGTAGAGCATGAGCTGGTTGTAGATCATGTTG
AAAATGATAAACACCAAGAACGTCTGCAGCACGCCCGAGTCGCACGGCACGATCTCACCGTTGAGCTCCACGGCCTCGCCCAGGAAACACCGGTGCGCCT
TACCCAGGTATGGGAAGAATTCGCTCCAGGGCACGGGCGGGTCGCTAAATGCTGGGATGCGGATGGTCCAAATCGACGCGATGCCGAAGAAGAGCTGGTA
GAAGCTGATCCAGGCATTCGCGTACCAGATGTCGAGGTCCGTGTCCTTGAGCCCCATCTCCTTGTACACATTCGAGGCGGCAGCCGGCAGCAACGACACG
ATATAGAGGATAATCCAGCCCGCCGTCGGGTCGGGCATGTTGGCCGATTCTTGTCCACTCAGGATCGGGATCATGTTGACGAGACCGCCGTACAGGACGA
GGATCGAGCCGAGGATGTGGCCGCGTTTGAAGCGCGTCTGCAGGAAAAAGTACGCGAGCACCATGTTGAACGGCAGGTTGAGCTGGCTCAGCACGTTCGC
GAGGTTGCCACTGTAACAAATCACATTTGGAACGAAATAAATAAAAAATCAGTGAGAGGACTGCACATACGTCGCGTGAACAGCAACGTAAGAAAGGTAC
CCGATGTGTGGCGTCGGGAAGGCTCCGAGCAGGTTGTAGAGCGCGTCAAAGAGCGCCATGATCGCGTACTTGTAGTGCGGGAAGCGGCGCATTTCGTCCG
TGATGTCATCTGCCATACATTAAGACACGTGCCACAAGATACTAATTAGCTCACTGTATACGAATGGGAAATGCATCAATGCACTCGCCAAAGCGGCAAG
CTGCAGCACACACGACGTACCAGTGCAGAACATCTTGTACCTGTCGTAACGAGCCATCATGAGAAAGAAGAACACACACACACGAGCAGTCAGCGCCTGG
ACGAGCCACACTTACATGACAAACAAATAAGCGCTTACCACACGACGGGCCACGACGTGACCAGGAACGCGATCGGGAGGATCACATTCGAAAAGTACCA
GAGGAAGATCGTGTAGTCATACGTGATGCGCCTGCATATCCAAAGCATGCAAACAGGCAAACAGGTGAGCATCATGCCATCCAAGTGGACCATCACATCA
CGCCACCATCACCATTAATGACAAGAGGACGCACGTGTAGAGCACGCGGTCGACGCATCGCGCGGCGATCAGCAGCACGAGCGCGACCGCGAGCTTGGAT
TCCAAGAGCAGCCGTTTGACGTTCATCGCGGC