Description :
From Genome Similarity Track
Location :
contig_13:946567- 949652
Transcript NameFunction/comments
g3002.t1hypothetical protein

Sequence
3085 bases(100 bases per row)
CTCGTCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGCCTTCATCACTGAAATAGTCGGGTGGCCGGCTTCGCACTCCT
CGGGGTGGTGTATAATCGACTTTCTCCACTGCCGAAGGTTGTTTGGCGAGCCATTCTTGGTACAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCCGTG
ATTCAGCATAAGCAATCACTTGCCATTCCTGGTACTTCCTTGAATCGAGTCGAACGTAGCCTGCTTCGACCGGCAAGTCACCATGTGGTACCCACATCAC
AAAGGGTAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACC
AAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAA
GCTCGGTAGGACCACCGAAGACATGCTTACGCCCGGGATTATCGTCATCCATCATGTTTTGCGTCTTGATCAATGGGATCCTGACCTCGTCCGGGAGTTG
TACAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCTACACC
TCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCGTC
GACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGT
GTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTCACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCTGGTAGCAATCTCACC
GTCTTGGCGAGTCCTCGAGGTAACTTTTCCTCAGCCACCGCACTCGAAACCCAGGCTTCGCATTCACTCGACCCGCTTTCTTCATCTTCACTCACATCGC
CTCCACCGAGGTTTAAAACTCTCTCCTTTTTATTGTCAGTCCATTTCACTCCATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACGTACGCGTA
GATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATA
CGAGGGTCTGGAGCTCGGGCGAGAGGTCCTTCTTGTCAACCTTGGTCTTGACGAGGTTTGCGAGTTCTTGGAAAGCTTCGCACTTGCCTGCATCATGCAC
TTGTTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGG
TCTCGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAG
TTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAA
GTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAAC
GTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGAT
CGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACG
ATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACAC
GTCTTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAAT
CACAGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAATCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATTGAG
CAGCTGCCAGTCGCGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCATCACTCATTAGGC
GGGGTATGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTGGGCGA
GGGGTCGATGCGTTGCAATCTCGAGTTTCGGTGTAACATTCAAACTTTCCATATTGCTTTCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTGTC
ACCATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCGGATCCTCGTTTCGAG
TTCCGCGTTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGAAAGTACGGGGAAC
GCTCGGCCGTCGTGGCGAATGCTCCACCCAGCTGTTGTTCACTTGTACCGGTGCCTCCATGCCGCTTGGGTGTTTGCGGTAATGGTATCATCGATGGGTC
GACAGTTTCCCCAGCTTTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCCAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCGGCT
CCAGCGGCTGATGGTGACCAGTCTTTCAGGATCACATCCGAAGGGTACGTCTGCGTTTCCAAGCCCATCGCAGTCAGCAGGGAGA