Description :
From Genome Similarity Track
Location :
contig_13:946527- 949612
Transcript NameFunction/comments
g3167.t1hypothetical protein

Sequence
3085 bases(100 bases per row)
CTCGTCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGCCTTCATCACTGAAATAGTCGGGTGGCCGGCTTCGCACTCCT
CGGGGTGGTGTATAATCGACTTTCTCCACTGCCGAAGGTTGTTTGGCGAGCCATTCTTGGTACAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCCGTG
ATTCAGCATAAGCAATCACTTGCCATTCCTGGTACTTCCTTGAATCGAGTCGAACGTAGCCTGCTTCGACCGGCAAGTCACCATGTGGTACCCACATCAC
AAAGGGCAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACC
AAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAA
GCTCGGTAGGACCACCGAAGACATGCCTACGCCCGGGATTATCGTCATCCATCATGTTTTGCGTCTTGATCAATGGGATCCTGACCTCGTCCGGGAGTTG
TACAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCCACACC
TCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCGTC
GACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGT
GTCGTTTACCGCTCCCATAACCAGAGCTCTCATCATTACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCAGGCAGCAATCTCACC
GTCTTGGCGAGTCCTCGAGGTAACTTCTCCTCAGCCACTGCACTCGAGACCCAGGCTTCGCACTCACTCGACCCGCTTTCTTCATCTTCACTCACATCGC
CTCCACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCACTCCATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACATACGCGTA
GATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATA
CGAGGGTCTGGAGCTCGGGCGAGAGGTCTTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGAGTTCTTGGAAAGCTTCGCACTTGCCTGCATCATGCAC
TTGTTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGG
TCTCGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAG
TTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAA
GTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAAC
GTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGAT
CGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACG
ATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACAC
GTCTTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAAT
CACAGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCAATGAACTCTGCATTGAG
CAGCTGCCAGTCGCGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCATTAGGC
GGGGTATGCGTCCCTTTCATCTCATAGATGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTGGGCGA
GGGGTCGATGCGTTGCAATCTCGAGTTTCGGTGTAACATTCAAACTTTCCATATTGCTTGCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTGTC
ACCATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCGGGTCCTCGTTTCGAG
TTCCGCGTTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGAAAGTACGGGGAAC
GCTCGGCCGTCGTAGCGAATGCTCCACCCAGCTGTTGTTCACTTGCACCGGTGCCTCCATGCCGCTTGGGTGTTTGCGGTAATGGTATCATCGATGGGTC
GACAGTTTCCCCAGCTTTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCTAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCGGCT
CCAGCGGCCGATGGTGACCAGTCTTTCAGGATCACATCCGAAGGGTACGTCTGCGTTTCCAAGCCCATCGCAGTCAGCAGGGAGA