Description :
From Genome Similarity Track
Location :
Scaffold_398:9462- 12579
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_398-snap-gene-0.19GTPase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_398-abinit-gene-0.32Ser/thr protein kinase

Sequence
3117 bases(100 bases per row)
GACGACGATGACGACGACGATGAGCACGGTTATCACGAAGAAGACTTTGACGACATGGAGTTCAGTGACGACGACGAGGACTTTGACGACGACTTTGACG
AGAACGACTTTGACGACATGACGTGGATGGAGCAGGGCAACGCGCAGTTTCTCGACGCCGCCGACCGCAAGGTCGAGGAGCACGTNNNNNNNNNNNNNNN
NNNNNGCAGAAAGTGCGCGTGCAGCGCGCCAAGCACTCGAAGCGCCGCTTCGTCGACCGCATTCGCATTAAGNNNNNNNNNNNNNNNNNNNNGCCATGGC
GGCAACGGCTGCGCGAGTTTTTTCAGTACGACGGTATTATTTTATGCATTTTAGTGGTTGGATGAGAACTGACGTTGTGCTTTTATGTATGCTCGCGCGT
ATAGGTGAGTCGGCGATGCGCAAGCGTCCGAATGGTGGTCACGGCGGCGCCGGTGGCAATGTCGTCATTGAAGCCGACGACCGCATCCAGAACCTCGCGA
ATGCGACGCACCATTTCAAGGGCGGCGCTGGTCTCAACGGAATGCGTACGTTATGCATGATCTTTGCTTGCTTGTGTTTGTATTTGCACTCACTCTTTGC
ATTTGGCAAATGATTCTTCGTTATAGCGAATGACGCTGCTGGTCGACGAGGCAAGCACTGCTTCGTCAAGGTTCCATGCGGAACGCTCGTCAAGCGCGTC
AAGCGAGTAAGTAGAATAGTATCAACTAGCAGCCTCATTTGAGGAGGAAAAAACATTGACTTTCGCCACGTTTTGCTGACTGTAGTTTGAACGCGAGTTG
GAAAACGGCGAGTTTGAGATCGTGGACAAAATGGAGACCGTGTGCGATCTGGACCAACCTGGCGCGACGTTCCTCGCCGCAATCTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGGCTCGGCAACCGCATTCTCGCGGGCAAGACCACGAACTTCGGTCGACTCCGCAAGCACATGCCTGACAACAAGGGCGTTGGTTC
GCCCGGTACGTCGCAGTACTACGAGTTGGAACTGAAGACCATCGCCGATGTTGGACTCGTCGGGTACCCGAACGCGGGCAAGTCCACTTTGCTGAGCACG
CTGAGTCGCGCGACGCCCGAGATCGCGCCGTACCCGTTCACGACGCTGCATCCGTACGTGGGCATCGTCGAATTTCCCGACACGTATCGGCTCTCTGTGG
CCGACATCCCTGGACTCATTGAAGGCGCACACCGCAACGTCGGCCTTGGCCACGATTTCCTGCGCCACATTGAACGAACCAAGGTATGTGTGCTTGATTG
TGTTTGGCTTGAGCATGGAGTCAATCGTGTGCTGATGAAGCGAATCTGTGTAAATGTGTGGTGACAGATTCTGATGTACGTGCTTGACACGGCGGGAACC
GAAGGCCGNNNNNNNNNNNNNNNNNNNNNNNNNAGCGACTTTACGCACTTGCAGCGTGAACTCGAGCTGTACGCGCCGGACATCACGACGCGCCCGTCGC
TGATCATTGCCAACAAAATGGACGAACAAGGTAACGAAAGAATGCGCTCTTGTTGTCCATGCAGCACAAAAGGAGACTAACAACATGGACGACTGGGGAA
TTCTTTTCTTGGTGTCTGTAGGAGCGGAGAAGAATCTGCACAAGTTGCGTCAAGCGACGGACTTGGCAGTGCTCCCAGTGAGGTACGTTGCAACTAATTG
GAGGCGCTGCTTGAGGCATGTTCGCCTTTTGTTTTTTTTGTTGCTGACAGATTGATTTTTGCTTTCGACCCTGTATTTCTCTCTTTCTTTTGTTATCTAG
TGCACTGCACAAGGTAGACATCGATTCGATCGCGCGAACGTTGCGTTGGATGATGGAGAACTACGGCAAACTCACCAAGTCATGATAGAAACAAGCGACC
ACTTTTCGAGAGAAAAAAAGTTGGTTTTTTGCCGTTGTTGCTTCAAAATATACCACATTCCATTTTCTACGGCCGCGCTTCGTAGTTGGGAGTCTATTAT
ACATGGGAACAACTCCTCAGGAATGTCAGATGCTGCTCTCCAGTCGTGCACCCCACTTGGTTGCGTTCCGAGCATTAACTCCAAGAAACGAGAACGGAGT
TGATCCCATGGATATTTTCGACTTTTCTGAGGTCATTTATAGCGAGCGCCAGCCTCGAGGTATGTTGTGCGTATACAGTGCTGACTGACAAACAGGTAGA
GCAGAGTCCCCAGACTTGTCACCTGCCTCTCAAACGCATACGCTCAGGCGAAAATGCATCGGTACGAGACGATGGAGCTGCTCGGCAACGGCTCCTTTGG
CGAGGTCGTCAAGGCACGGTCGCTCAAGACAAACGAGATCGTGGCGATCAAGAAGATCAAGGCACTATTTCCGACCTGGGAAGAGTGTCTGCAGCTCCGC
GAGCTGAAGTCGTTGCGNNNNNNNNNNNNNNNNNNNNNNTATTGCGCCACGAGAACATCGTGCAGCTCAAAGAGGTGATCCGCGACAAGGAGGAGCTCTA
CTTCGTGTTCGAGTACATGCAGTCGTCTCTGTGCAAGGTCATGCAGCTCGCCAGGCACCAGCAGCAGGGCGAGAGCGATATTGCGGGTGCAACTAGCAGT
AGCAATGGCACTGGCGCATCGTCGTCGTCGCCTGCTTCATCTCCACCATGGCTCTCGGAGGCGCAGATCCGCTCCATCATGTACCAGCTCTTCTGCGGCC
TCGCGCACATGCACAAGCACGGTTTCTTCCACCGCGACATCAAACCGGAAAACCTGCTCTGCCACGAGGACACGCTCAAGCTCGCGGACCTCGGTCAGGC
GCGTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTCCTGAGCTGCTGCTGCGCTTC
CACTCGTACAACAGTCCGATTGATCTATGGGCGTGCGGATGCATCATGGCCGAGCTGTTCCTGCAGGCGCCACTGTTCCCAGGCTCCTCTGAGGCCGATC
AGCTCTGTCGTATCTGCAAGGTGCTCGGCACGCCCACAAAGGACACGTGGGCCGACGGCATCACGATGGTCTCGCAGATGCAGTTCAAGTTCCCGAAATG
CGCGTCTGTGCCCTGGA