Description :
From Genome Similarity Track
Location :
Scaffold_26:94605- 96366
Transcript NameFunction/comments
Physo_133420hypothetical protein

Sequence
1761 bases(100 bases per row)
GGTAGTTAATTGTGGTAAAATGCGTATTTGTGGTATATCTGGATTTTGGAATGTAACTTCTATGTACATTTGGAAACCTATTTGGGGTTGGATATCTGAT
CTGTGACTGCTCAAAAGATATGTGGACAGTTGAAGCGTCATTTGTGGCAACAATGGCGACGCTCGAAGCTACCGGTGCTCTGGAGGAGCTCCTGCGGCAG
CAGCGCTCTCTCGTAGATCAAACGCTGTTCCCGCTGCTAGAGGACGCACCGGTACGTGTTCTTTGTCATCTACGTAGTGAACTGCGCTTTGGTTTAGGCG
ATTTTTGGCTCATGCGTTCGACTTGTGGCAGCTCGGAGGCCTGCTGCAGCTTTTCCAGTCGACGCTGCTGGCTCTGCAGAGTCAAGAGCCGTCTTTTTGG
CAGCTGCAAGTGGTGAAGTTCATCCGGAACGTGCTCAAGACGCGGGTGGGCGGCTGCGTGCGAGACGCGGTGAGATCTGCGGCCTCTGAGGAGCCGCAGG
ACCCTGTGCAAGTTGTTGCAAGTGCCAAAGCTCATGTGGAGAAGAGCAGCGAGCTGGAGGGCGCCTTGAGACAACTGAGAAGCGATGTGGAGCAGGAGGT
GGCCAGGTTGACGCGTCTGCTGAGTGCTGAAAAGGAGAACAAAAGGGGGTTTGAAGGTACAGACGAGCACTTCCTGGATCAATTCTGGGACAAATTGCAG
AAGCTGGCGGACTCGAGAGAGATGCAACCGAAGTCGGACGAGGAACGAGAAGCTGAAAGGGCTGAGGAGTCGGAGAGCTGCTCCTTCGAGGTGCTCACGT
TCGACGATGATCTGGACGATGTGTCCAGGTCCGCAATGAGGTGGGCGATTAATTGGGCAATACCAACAGGGGAACACGAGGGTTTATATCGACTAACTGG
TTGTGATCTGTGAATTGGGATACAGTTTTCCGTGCATGGAGGATTTTCCTGGGACGGTTATACGGATGCAGAGCACTGATGCGCTGGAACGTGCGGTGGC
GCTGGACGAGTTGATGCAGGTAAGAGGAAAATGTTGGCTCTTTTGGCTTCGAAGCGTACCAGATTTTTCACAACGTCACTGTGCGTGGTCTGTGTAGGTG
CCCATTGTGGAGATCGTTCACTCTGGACCAGTATTCCTTGCTGCGTGTTCTGCGACTGTCGGGTTGTTCCTCGATGTTGATATCCGGGGAGAAAAATGCG
ATACTGCCGAACGTGCTAAAAAGGTTATATTCGACCTGATGAGCCAAATTGAGGACGCTGCTCAATTTCTGGAACTGTATGGAGCTGTCCTCGAGTTTAT
GGGGTTGCAATTGAATTCGGACAAACTGAACTTGGATCGCCAGAGCCTTTTTGAAAGTGCCGATGCGCACTCTATTGCCGTTTTGGATTGCTTTCGTGTT
TTGCACGCGCTGATTTGCCGAGTTACGCGGCACTGGGTGTATTTTTCAGCTGATGCACTCGCTCGAGTGATGTTCTCGACGTTTGATCTCCTGACGATGT
ACTCCAAGACGGAGACTGAAGTCGAAGCAAAGCGTGCCAATCCTCTTCTGATGATGGCCTTGATCGATGATTGCCCCATGCAATGGGTTAGATTGTGGCT
ACTAAATTGCCCAAGTGCACGGCAACTGTTTGTAGCGATGGAGGAGTCGGGTTTCATCGCTGATTTACTTCAGTACATGTCTCGAGTTCGGCCTTTGGCT
TTGATAAAATCGACAACGTCCGCAACCGACGTCATTGAAAAACGCGCTGTTCAGAGTGTAA