Description :
From Genome Similarity Track
Location :
Scaffold_433:9460- 10652
Sequence
1192 bases(100 bases per row)
CCTGACCCACTATAGGGCCTACCCACGCCTTAATATCGTACACTAAATTGCCATTTAGGGTGACTTCGGCCTGAGTGCACCCTTCCGTAGAGTATACCGA
TTCCCCAATACCTATACACTCTTGTCTTCGCTTTCGTCAATTTGGCAGCCTACCTAATGAGCAAAAGTGACATCTAAAATAGATATCTTAGCGCCAGTAT
CGAACAACAAATTTGCGCGACCTTTCTTGATCTGTCCAGAGCGTTTGGCTTGTTTAAACTGCTTAGTGGGTGCATGGTATTTCCAGTATCCAATGGGTCT
CCAGGCAGTAGTTCCAACTCCATCACTGCATTTTCTTGGGCAAAATCATTAATTTCATTGAGACAGGACAACATGTACCACAGGGCATTTTCCAAGCTTC
GATATATTATCGGTCTTCTCAGTAAAAAACCCTCTCTCCTCCTTGGGCTGCTTTTCCGCATTTGCGAAGATACAAAAACTAAAGCGTTCGACTCTTAACA
GATTCAAACCTGGCGAGCGTTCTAATTCATATCTTCTCAGTTACTCCGGCAACATTCCGGCGTACTTAATGGGGATGTACCATTGACGATTCGAATTGTG
GAAGTCCTCTAGATGGCACTACCCCGCTTCGTGGGTCTCTCCGCATCCTTGGCACACTAACAAACAGCGATCTGATGGGTGCCCGTTCTTCCCACTGCGG
TTGCAGGACATTCTCTTCCAGCATCTCAAATCTCCATGTTTCCTGATATGCTGTGGGCACATCTCAAATTTGACTCGGCCGACGTATTGCGGGTTCCTCG
GTCTTCTGCTTGTTTGCGATGCTGGTCGAACTCTCTGGTGGGTCGTTCCTTAATGGTTCTTGTATTTTGGTATCTTTCTGCTTCCTCTGGATAGACCTGC
CTCAGGTCTTCCTCGTTATCCGGATTATCCAAGCTGGACCCCTTCGAGCTCAACTCTTCCGGAAGCGCTCGGACCGCATGTACAGAACGGCGGTTGATAC
CTCTACGTCGACCAGGAGGGACGAGCACCTTTTGTCGGCACTTTCTCGAGCCAAACCGTGTGTTGCCACGCGGCTCCTTCGTTCTCAAACGCGCCTTCAA
CACTTCCTCCAGTTCTTCCACATATGCCAGACGTAGCATCGTCAATTGGTCAGCCAACTCTGGGTCGTCCACGGTCTCGATGTAATTCTCTA