Description :
From Genome Similarity Track
Location :
contig_2:945827- 952445
Transcript NameFunction/comments
g725.t1hypothetical protein

Sequence
6618 bases(100 bases per row)
ACACCTCAGCTTACCACTCAACGCGAGTACCGTGAGCGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTGCCGCAAATGCGGACGTATCCAGTGGTCCTAC
TGGCTGGCGAACGCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGCTGCAAGCTAGCTTCAAG
AAGGACGACGTCCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGCTTCCAGCCCCGCCCTGCGCGGG
CTCCTCAACATGCTCCTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCT
CGCTCCCCGACCTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTCGATCGTTTCGACCAAAAGCGTCCACGACGT
CAGGGCAGTCTTGCCGAGGGGTACCTTAAACTCCCATGAGTTCTGCGAGTGGTGGGTACCCTCGCCACTTCACCAGATACTGGTATTATTTTTGGCGGCG
ACGCCGAGCCACAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGACGCTGAGTTGCACTGGGTGCATCGTTCGGAG
CTTGAGGACGCTTGGAACGCGAATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCAATCAGGCGAGAACGCCTATGATCGTTCATGG
CATGAGATTGATCAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGGTCTCCGACCTTGAGCGAGATCTGGCGAGGCTGG
AGGGTCAAGTCGACCTTCTGCTGCGACTTCAGCAGGGTGCTGTGGCTGCGCCACCTGTGCACGTCCCAGTTCCAGCGCCTCCGTGCTCACCCGCGCCGGT
CCGGTACGGCTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTCTTCGGAAGGTTGAGCGTATACGCTGGCCCTTCTTGGCCACGACTTTGAA
AGGTCCGATGAAGCGTGGGCGCAGCTTCGTCTTGAATACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGGTTTAATAAAACCAAGTCTCCGACTGCGT
AACTTTCAATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACG
CGTTGACAGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGT
GGTAGCGTCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGA
GTGGAAGCATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTG
TGGATGATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATC
GACTCGGGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGGTGTCCGGCACCGCCGCTAGATGAGCCATCT
TGCTCAAACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCAACTCATGGACTCCCAACACCCAGAG
GGTACAGGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAA
GCTTGGGCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTGTCGTGTGCCTCATAGAGGATACGATA
TTTCAGATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCGGTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTC
GCGCGTAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAG
CGCGGATCAAGTCCGTCACGGACGACGTCACAGTCGTGACATGAGATAACTCATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCC
AGGCTTGTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGAC
GCATGATCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTG
GATAGTTCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCAGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAA
GTCCGATGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACT
TGATGCTCGGTGTCCCAGGCCCACTCCGCATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGT
TGGCGAGGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTT
CCCGATGAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAAATTATTAGTGCGCATGCACTCGAGCACCGCT
CGCAAATGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGTCCGATGGG
GCCGGAAGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTGGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCT
GACCGCTGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTC
TGGAGAACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTC
TGACACAGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTC
CCTTGGCAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACACACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGA
TCGTTGGAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCT
TCGTGTCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAAAGGCGACCTCGGCTAATTCGCCCGTCTTTAAGGC
CTCGCCGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACT
CCATTAACGAGTGTATATAGCTGTTCGCTATCCACCACCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGTGTCGCT
GCCGTCTCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGACGTCAAACTCGACATCC
GGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCCACGATGCCTCGGCTCGTGGCCGA
CCGCGCCATCGTTGGTACGCAATGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGAATTCATCAGGGCTATGCCCAC
GATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTAC
AGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGGCACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAA
TAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATCC
ATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATCGAAGTCCAGAAA
CTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCG
GCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAAAGCCCTTCACGG
TCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTC
AACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCAGGGCTTCGGC
TCGCCGGAGCTGGCGCTGCTTACGCAGCGGGCACCCTGGTCGCAGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGCTGCTCGGCAG
CAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGCCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCTGCGACGTTCC
CCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTG
GCCACGCCAGTGCGAAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGTTCGTAACTCTTGGA
CGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAG
CTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCCAGCTTGGACACGGCCAGCGCC
ACGCGCTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCCTCAAAGGTCT
TCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGAGCGTCGTAGACGCTGTCACAGCCGTCATCTTCTGTTGTAGATGTTC
CAACAGAGCATTCTCATAAGTCGAGAACGCCTCCAGACGCGCATTAATTGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTTCCGGGCCCAACAAG
GACATCAGCTTTTTAAGCCCGTCCTGTTGGTTCGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAGGTGTAGGATTGA
CTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACCTTGGTTCTATAC
CAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTTCAAAACGTGAACTC
ATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATATGCATGACGGGTGGC
TGTGAGGCCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGATACACTAACGGGTAC
GTGTAACCCCGTTACAGT