Description :
From Genome Similarity Track
Location :
Scaffold_7:945822- 953780
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05326hypothetical protein
Phypa_INRA-310PPTG_05327hypothetical protein
Phypa_INRA-310PPTG_05328hypothetical protein
Phypa_INRA-310PPTG_05329hypothetical protein
Phypa_INRA-310PPTG_05330hypothetical protein

Sequence
7958 bases(100 bases per row)
GGGGGCGATGATCTAGTGGTCAACATGTGGGAGATTCATCCTCATCAACTGGACTTACTGGAGGCTCGAGGTACCCCTCGAAATCCTGAAGTGTTGGAAA
GTGAAGACAATGCGGTGGAAAATGAGCTGGACGAAGACGATGTGGCTCTAGCGCCGTACCTAGCGCTCCTGGAAGGTGGTCGCGATGGGTCATTTTACCA
TGAGATTGTAGATTATTTCTACCTGGCTCAACTTCGTGTCCAAGGAGAAGATTCTACTAGTGCTCGGGAGATCACGGCTCAAATTCCGCTGCGAGAGATA
CCAAATGTGATGCGAGCGCTGGGATTTTACCCCACGGACGAGGAAATTCAGCACATGGTGAGTGAAGTACGCTATTCACGCTTTACCGAGACGTCTCGAC
CGGTGGAGAGCATCGGTCTTCACGACTTCATCAAGTTGTACGTGAACCATCGGCCGGTTTTTGGGGTTGGCAAGGCACAGATCGAGCGTGCTTTCAAGAT
CCTAGCGTCGGTGGATAGAGGTGCTGGCGATGACGAAGATGACGGCTTAGCATCGTTGCGATGGGATCAAATTGAAGCTCGTCTGTTAAACTCTGGCGAA
CCCATGAGTGAAGAAGAGTTGCGAAGCTGTCTTGCAGCATTGCTTGCAACTGGAGACGAGAACGGTGGACTGGCCATGGATCCGCAGTACACTGCACTCA
GCTTTGCTGATAAAGTTCTAGGATTCGACGACTACGAGCAGCCAGAAGAAGGAGAGAGCAACGTTGTGTAAGTTTAACGAACAAGCAGTTTCTTATGCTT
TACACTTAGATTGTAGCTTCGTCAGCGAGGCATTGATAGCCACACTGTAGTTGTCGGTCATGTTCATCGTGTTCGACCCAGAGATCATCTTGGGGTTGTT
CTGAGACCGTCTTGTTCGTGTCTGGCAACCATGACATCCTCAGCTCTCTTGCGTTGAGTGTGCCATTGGACTTTGTGCTGTTGTTGCAGATGACTGAATT
CCGTGCTCTTGACTTGGAGTGCAGCAGCAACTCACGGACTCGATCTGCCATGGAGACTTTACGAGGTTTCTTTGAGGCGCCAATTGTACACTCACGACTG
CGTGAACGAGGCGAAATGCTCCCGTCCATTGTCATGTAAGCGTCTGCTGCGGTTGAAGTTGAGCGTTTCCTTGGGGTTGATGCTGTAGGTGCGTGGTGGG
AAGGTGGAGCGAGCGGGAAGTCGAAGATGTCGACGAGGCGGTCGAGGAATTGATCGATTGCGACTTGAGCTGATCGGCGACGACGCAAGACTGCTCCATC
AAGCAAGGACCAGCGTTCCTTTCCTTTCATTGTATGCGACAGCTTGAAGAACTCGGATGGTGAGGCTTTCTTGTGGCGTACGGGACTCGATACTTACCGA
GTAAATGCAGTAATGAGGAAGAGATTTGACAGGCCACACGAAAGAGGAGTATTTCGAGTGGGAGAGATCGCACGCCACCACAGACGGAGGAATAAGCTGA
AAGTCAATCTGCCAGCATCTGGGAAATTCTGTCCACCATGCAATCCACACGCAATGACCGTAATATCTCGAGAGCGCACCATGCAGTAGTTCACTCGGGA
TTTGATCTTGGAGAGATGTTGCTTTTCGCTGGTCGTAAGTGGGTACATTCAGATGGCTACATTATTGATGATACAAGCGCACAATGCGCTCAGCTCTGGG
CGATTCATGCTATCTCTTATTCTCTCTCTGACGCGGGAACAAGGGCTCAGTCGTAGTCGTTATCTAGTACGTAAAATAAACCAAGCTTCGTTGTTTTTTA
TACTGGGAGAGACAAGCATGTAGGAAGCTACTCCTCAACAGGGAGAGGAAGTTACAGGTGTCATCCACTAGATGACAAACTGGTGCTGGACTGTCAAGCG
CGACGGCATATGACCTCTCGAGGTATATTTGTCAACAGCAGGCACGCTCTAGATCTCTCTTCATCACACGGCTGGAGTGATCTCTTGTGATGGTCAAGTA
CATTGCTATCATATCGTTCAACACCATGAAGTTACTCTCGACCACAAAAGAGATGTGGGGAGGAACGGCTCGCCCCGCTCATTCGTCAATAGGCTTCTTT
CTGGCTGACAAGAACGATGAAATATGCTGCATTTGTGCTGCTATTAACGTGCTGGATCGTGGCTGTAGAAGCTGTGAATGAACGCGATCTTCGTCTAGCA
CTGGCACAACTTGTAACTTCATCAGAGAATCAACACAGCGTCACGGTTCAAGACTTACTTGAAGGCCCTCCTGAGCTTACTACTTCACTCCCGCTGTTTA
ACCAACTCGTCAGAGAAGACCGAAGAGAACTTCTTTGCCAAATTGGTGAGCTACACCTCTTCGGAGACGGCTCTGTGTCTCACAACGCGACTCATGCTGA
GCTATTCCTCGACGCTAGTGCAAGGTTAGGCAGTGCTCAAGCGCAGTTCCTGCTCGGTACTCAGCGAGCTTCATCTAATGACAGTGCATCTGCACACTTG
TACTACGAGTTTGCTGCTCATGGGAGTTCAATTGGAGCCACAATGGCACTTGGATATCGTGCACTGCACGGCTACGGCTCCACAAAGTCGTGTTCAACTG
CGATGAGGCACTACAAATTCGCTGCGGATCGTGTTGTGGCTGAACAGAGTGATCAAAGACTTCAACTGTATGCGTTCCCAGAGCCTACTCGGCTTTCAGA
GACTGAAGGAGCACGATATCACTTGGACCTCAACCCCGCTGAGGACTTCAATCGAGCTGAGTACCTTCGACAGCGTGCTGCAGATTTCCGTAGTGCAGAT
CTGATGGTCCAGTCCGCGAGTATCACTCTGTTCAGTGATCTGTACAAGACTGCAAGTACAACTAATTTTGAGGAGCACACTGCACGAGAACGACAAGCCC
TATTATTTCTAAGACGTTCAATTGAAATGGGGAATATCAAGGCTCAAGCGCTCTTAGGTCACGTGTACGCTTACGGTCTTACTGGATACCCGGTTAATGT
TACGAGAGCTGTGGAACTGTACGAGTCTGCGTTGAATGCGTCGCACAGCAGACCAAGTGGCGAAGCTGCTAATGGTCTTGGTGTGATTTACTCACAAGGT
ATCGGAGACGTACCTGTAGATCTCGAGAAAGCTCGAAATCTCTTCATGGTTGCTGCAAATGCAGGGCATGCTGAAGGTGTCTACAATACCGGCATGGCAT
TCATGAAATTAGGAGCGTACCACACAGCGCGTGCTAAGGAATATTTCGTTGCAGCGGCACATGTGGGTCATCTCAAGTCGCTCTTCCAACTCGCTCGGAT
CAAGCAGCGACAGACTCATGATATCGGCGCTAGAGCGAGCAGTGTCTCGTGTGAAGAGGTTGTTGAACTCTATAAACGTGTGTCTGAATACTCTCGTGAA
GGCACAGCATTAATGACACAGGCGCTGACCCACGCCCAACGTGGTAACTGGGCGCTCGCACTCGAGTTATACTTGATTGCAGCTGAAATGGGCTACGAAG
TCGCGCAGAGCAACGCGATCTGGCTCATTGAACGCATACAACGGCAAATATTTGGCACTTCAACCAGTCGAAACTCGAAGCTACTGGGACGTTTGTACGC
GCAGCTAGTAACCCGTGCCGTTGGTCAAGATAGCGTCGAAGCATTACTGCGTATGGGTGACGATGCCTTTCAGGATCAAGACTATAGTCTAGCGTTGAGG
CGCTATCAACATGCTGACCTAGTGAGTGCTGGAACTTGCGCTCGTGCTCTCTACAGCGTCGGCTATATGTACGAGCACGGTTACGGAGTCTCTTTCGCTT
CGACGGAGCGGGCCTCACTGTACTATCATCTCGCAGGCGTGAAAGAACCATCTTTACGTCTTGTTATGGCTGCGTTGAATCTCAAATTACGCGTCCACAG
CACCTTTAACCAGTTTATCAACCGTGTACATCAGGCTTGGACAGCAACGACACATGAGGCTGCTACAATTGAAGACTCATCAACGCCACAAGACGAAGGA
TCGATCCCCACATCACGTGACATTTCAGAGTTTGACAAGCCAAGTGCTTACCATCGATCAATGAAGATGCTTGATTCGGATCAAGGCTCGAGCGCAGATA
GCAGCACGCCACACGAATACGCTGCTGCGTTACGATTCCAAGGGGATCTGTCCCAGCTTCTTATTGAGTTTGCTCGCGATGAATTGCCATTGGAACAGCA
AGACTTTACTATTGAAACGTGGTTGCGTATCGACGACTTGCCATCAGATGAGGTGGTAACTCTAGTCGATGCATTAGACAATTTCCAATTGGAGCTGCTA
CGTGCCTCTGGAAATGTGGATTCCTGGATGCTGCGATTCCGAAAGTTTTCTTTAGTGGATGAACAACTCCCTGAACTTGTGCTTCGCTTTCCCAAAGCTC
CATTGACTCCGCATACGTGGTATCATGTGGCTATTACGTTTGATGCCACATTCCAGACTGTCATGCTATTGCTCAACGGTAAAGTGAAGCAGGTGCTGAG
TTTCCGTCCCCATCCAGCAGCACTGACTCGCAGTGAAGACGCTACTGTTGATGGAGATTCTTCATCCTCCTCAAAGTTCCTCGCTATCGGGAGTACGATC
GGTCGTATCTATGGAATGAGTCCTCCCAATTCTCGAGTGTTCTCGGGCCAACTTGTACACTTTCGTCTGTGGAAAACGCGCAAGACTGCGAAGGAAATCA
GTGTGCTTATGCTGGAGCAATATGATGAAGTGGCAACGCGAAATTTACTGGTTCACTTGCGCTACAAGCTTAATGGTGCGTCCATATCCAGTACCAGTTC
GAAATCAACGAATCGAGTGATGAATGGAGACCAAACTGTTCCTGATGCTCAGGGCGTTCAACTTAAGATCGTGGAGTTCCCACCATCCAACTAACTCTAA
CCAGAGTACCAAACCATCACAATGATGATCCTGCACTGAGCTTAAGTAAATGTTAGTCAAACAATTGCGTTTCTCGTCTTCGTACTGGTGTTCGTTTGTG
TTTTTATCCAATCTGCTAACAGAATTCAGAATTCCAAGTGGGAAATTCGGTGTCAAGAATTTTAGACGTGAGCAGCGGTACCAGCACGGGTCGGTGCCTT
TAACGATGTCTCCTTCACCTTTTGGCGTAAGAAATGATATCCTCCGACGAAGAAGAGGGAAATCCACTCCAGGAAGGTATTGTTGCGAGGTGCAACGCCG
TTGCTGAGCATACGCAACAAGAAGCCGTTCCACGTGGTAGTAATCGAGTACTGGCCAAACCACAGACCATTGAAGAGAACTTTCGCTTTCTTGTCGAATC
TGAACATTAACCGAAACAATGTGAATATTACAGCTCAAAAGCTCGCGGTTAAAAGAATTGACTCACGATTTCGTCGCTGCCGGACTTTGATCTGTGAATG
TTGAATATCCTAAACAACAAAGCATGTTACATTAGCTTAAGCGTAATAAAAATGATGTACAAAGGCTCTCATTGAACCTACCCGTTGTGATGCTGCCCTC
GTTTGCGCTACACAGTAATCGACAGTAAAGATACCAATTAATCTTAAGCACAGGAAAAGAACACTGACTGGATCATTCACAATGCCATACCTCTCTTCGC
CAGCCTCGTTGGAAGTTGCAGGGGATTTAAAGCTCTTTGAGGTGTCCAAGAGGTTGTAGGAAGACGTGCCTGGATAAAAGACCGCCACCGAGATGTTGTA
CAGCAGCAGCTCGTTCCGCAAGCTGTCAGCCAGTCCTCGAATGGCGCTCTTCGAGCCACTGCAGGCACCGCAACCCACAGGGAATTCGAGACTGTCCACG
CTGCTCACAAACACGATGCGTCCACGGTTTTTCGCTTCAATCATCGCTGGCAGAGCAGCCTATTCGGAACAAAAACAACGTAAGACACAGGTTGCATCAA
ACTAGAAGCAGATGGAGATGAATCTACCTTGATGAGGACAACAGCACCAAGGTAGTTGACATCCATAGCCTCTTTCATCAGTGCAACATCCTGTTCCCAG
AAGTACCCGGGCTTGATGCGTCTGCTGGCTGCGTACACGATGTGATCTGTGGCTCGTCCGTGGAAGGTATTGGCCTCTTGCACTGCCTGTTCCACTTGCT
TTGAGTCCACGAGTTCACACTCGAACACGAACACCGAGGCATCTTCTCCTGCCACTTTCTGCATTGATAAAAAAATATTAAATTTGGTTGGCAATAACAT
TACCAATCGAGAGTTTTCACCTGGAGTTCACTTTGCGCTGCCTTGAGAATTTCCATCGTAGGGCCGATCAGCGACACATTTGCCCCCTTCTTGACATACT
TCTTGGCAATTGCCAGCCCCAACGGATTTTCAGTGCCTGAAGTGGCATTCGTTAGGTAAAATGTTTGACAAATATTGTGTGCACAGCCAACGCACCAGTA
AACAGCACGTGCTTGCCGCGCACATTGAAGCGTGGCGCAGTCAGCAGAGACCAGAGCCACGAAAGCACGCAGGAGCCCACGAGAACGATGAGGGCGATCC
AGCCGCTCTCCATTGTTCACTGCTGAGGAGTGACGAGCTGTTGGCGGTACAGAGCGAAGTGGACAATGGACTCGGCTTGGGTACGCGCGACGTGCCCATA
TAATTTCCAAGATAAACGAGTTCAGTGTGGTACAGTGTTTACAGTCAGTACAGTGTAAACTGTAGGCACGAGCCGTCTCAAAGGGATAAGCGCTGACAGC
TCAGCCAATTGTTGCCGATTGCGGACAAATGATTGCAATCGAAGGAGCTCGGACGTAAACTGCTGATCCTGCATCATTTCTTGCCGGCACTGCTCTGCAA
GATTTTGGTGTCGATGAGAATGAAACAATGCATGTACGTGTAGAACCATTAAGCTGAAGGAACGAAACTAGTTTATCAACGGAAGCTTGTTGATCCGCAT
TTTTCACAAAGGTTACAATGTGAGCAAGGATGTGCTAGTGCTTTGCGCTAACAACTGCGATGATTCATCACCCTATGAACTTCATCATGAAGCCCTAAGG
ATGAAGCTGACTGTTTTGTTTGGGTTCATCATCGAAACAAATCTGGTCCAAAGCTGGTTCATGTGCAGTCACGATGCGTTTACAGTACGGTACCTACATG
CATTTCCACGATGACTTACATGCCGGTGTAAGTTATCACCACATTACAGTCAAACGACTATACCGATGCATGTCGTCAAAATACACGCTGGTTAGAACAG
TACAGCAAGCGAGCAACCAACACAGCCGAAAAAAAATAAGTAAACGCATTCCAACCACTTTCCAAAAAGCACATGCGATGAAAATGGGAATAAAAACAAG
GAACATGCGAGCGGCTTGAGTTTCCCATAGATACCGACGTCAGAGGAGACCGTCAAGCCGCTCGCGTACCACCGATCTCCTTACAGTCCTCTCTCTATCT
AGAACTCCTCCGAACGAGGCTTTGCGACGGCACGCGGCTTCGGTGCCGGTGCGGGCGAAGGCGTGGAGTTCGACTTGGTGGGTGCCGACTTGGGCGGGGA
AGTCACGGTCGGCTTCGACGGTGCCGGCGACGCGGTTCGTGTGGGCTTCGGCGAAGGAGTACGGGCCTTCGGAGTCGGCTGCTCGTCGCCGTTCACGAAG
CTGCCACTCTCCGAGCCGGGGCTGTGGCGGCCGGGGACGCCACCCTTACCGGTGCTGCGGATGGCCTTGGCCTCCTCCTGGTCAATGAAGCGAATGCTGT
TGAGCACGTACTCCTTGTCCGTCTTCATCTTCTTGAGGTTGGCGTTCACCACGTCCTCCTCACTCACAGCCGCGTCGACAGTCACACTGATGTCCTTGAG
CAGTCTAGAGTCGATCTCCGAGATGTTCTTCTTGAACTTAAGCAGCTCCACGATCCACTGCTCGGACGGGTGCACCGCGTCGGCCAGCTTGGCCTCGTTG
TTGCCGCCCTTGTGGTTGGAAGACGGGCCGTTCTGACGAGCCATCTTTTTCTGGATCT