Description :
From Genome Similarity Track
Location :
contig_229:9458- 10831
Sequence
1373 bases(100 bases per row)
AGCTCCCGATTTTTTAGCTGCTGGATCGTATTGCTCAGCAGGGAGCGGCTTGGGCCACGAGCGAGACCTGGATCTGGATCTACGTGGGCGCTTGTTTCCA
CTTAGAGAAGGACCAAATCGACTCCCGTCTCTGGACCATGGCGATACGGCTGGAGGTGGGCCACGATCGTATCTCGAGGACCGATTACCATTTTTCAACG
CAAGAAGACGATCTCGTTGCCGTAATGGGGTACTACGTGCACTCCCATTTTGCGATGAAAGAGGAGACGGTCTCGGTGCATTGCGGTCGCTTGAACAAGA
TCGCCTCGGGGTGCTTTGGAACCTCATATCTGCAGCAGGGGAAGAGCATGGGCTGATACTCACGCCCGCCTTATACTCCGTTTTCAACTCTAAAGGTCCC
CCAAAGTCATCCCGGAAGACTTGTGACGCCTGCTTGGCGTCCTCGCGATTGTAGAAGTGCAAATATACCGTACCAGATTGATTCTTCATCAGTCTCTGCC
AGTTTTCGCGTGGGATATCGCAGCGCGGCACGGATTTGTTGATTGTATAGCGCTTCACCAGCGAGGCAGCAAACTCCTCGCGGTCACGATCCTGATTAAA
TCGGATGCCGGTGGACCTCCGCTCAAAACGCGCGTTGCGAATAATCACCGTTATCCATCCACGTAATGACTGCGGTACGAACGCGGTCCCGTACATTCGT
TGTTGGTAAAACTCTCTGTCCTTAGGGCGCTCGAAACGCAGCTTTTCATAGCAGTTAATTTCGCGAGTCTTCGGTTCGTCGCTGATGTATTCATCAGAGT
CGGGGTTTGCTTTTTCTTTAGACTTTGGGGCAGAAAGTGATACACCAAAGAACGAAGCGGCGTAAGATTCCCGATTCAACGCAATTTCAGGCTTCGTAGC
GCAGCTCAAGCGAGGGATCAAATCAGGCAGTACTTCTCCATGGACGTCGAAAACCTCATACCCAATCGTGGATGGTGCTGATGCCTTATTAGATTGAACC
GCCAGCTCTGTTATTGCCATGAAGATCGAGTTACGCCTCTTGGACAGGCGCATCATGGCTCGATCTTGCTTAGAAATCGCCATAGGCTTCACTGGCACAT
GGTTCTTCGTCCGCTTTCGTCGGGGGCGTATAGGGTCAGGCTTTGACAACTGCGGGCTCGATTCAGGAGACGGCAGTGGTTTCAATACGACGGGAACACG
GGACTGTAAAAAGCGCTTGGTACCACCCATGTTCACTTGCCCCCGAGGTGCCTCTTTCTGACTCCCTGGTTTTGCAAAAGATCGCTTCGGGATCACAAAT
TCCGAAGCATTTGCAATCGTGGCTGATCCATTTTCAGCAGTTTTCCTTGGGATTGGGATCGCGTCGGGCAGTA