Description :
From Genome Similarity Track
Location :
scaffold_18:94564- 96581
Transcript NameFunction/comments
Plaha_PHALS_05465myosin-like protein

Sequence
2017 bases(100 bases per row)
TAGATGAGACGACAATTTTATCAGCACTTGACACACGCTTTACCAACAATAAGATCTACACAAACACCGGAGCCATTTTACTAGCGGTAAATCCATTTCA
AAAGATTCCAAATATTTACAGCAAAGACACGATGGCTAAGTATCTACTGTCGTTTGAGTCAAGAAGCTCTACTATGCAGAATAGAGGCAACGACCGTATG
CCTCCACATATCTATAAAGTGGCTGGAGAGGCATATAAAGCCATGATGCTTGGACTAAATGGTGTTATGAGTGATCAGAGCATTCTTGTGAGTGGAGAAA
GTGGCAGTGGAAAAACAGAGAGCACGAAATTTCTTATGGAATACTTAGCGCAAGCAGGAGTGACGCATGTTGCATCCACTGTAATTAGTAAAACTCCACA
AGGTATTGCAGCTAAGGTCCTACAAACGAATATTCTGCTAGAATCTTTTGGAAACGCGCGCACATTACGCAACGACAATTCAAGTCGATTCGGCAAATTC
ATCAAGCTTCACTTTACCAGTGGTGGTCGACTTACAGGTGCCAGTATTCAAACGTATTTGCTTGAGAAAGTGCGGCTTGTTTCGCAGTCAAAAGGCGAAC
GAAATTATCATATTTTTTATGAAATGGCGGTTGgcgcaaaagctgatgatCGAAAGCGCTGGTTTCTGGACCCACCAAAGGGTCACTTGATGCCTTCTGG
AGACCACGGCGATGTCTTAGAAGCCTCACGCCAATTTTTGCATTATCGATATTTGAACCAAAGCGAATGTTATCAGCGAAATGATGGTGTTAAGGACCCT
GAGATGTTTCAGCGTGTCATGGAAGCTATGGATATTGTTGGCTTTACACTGACAGAACGTGCTGGGATTTTTGACACAATCGCAGCACTCATGCACATCG
GAAATTTGTCGTTTGAGCACGATGAGAATTGTGATAGGGTAGGGCAGTCACCGGGACCTGGACAAGGCAAATCAGACCTGGCACCGAGCTGCATCTGGTC
ACGCGACGCAGCAGCCACACTGCTGGCTGTGGACGCGACAAAACTCGAGTTAGCTCTGAGTGTGCGACGAATTCGTGCTGGTACCGACTTTGTGCGAATG
AAACTTTCTGCAGCTCAGGCTAACAACGCCCGCGACGCATTGGCCAAAGCCCTGTACGGACGTTTGTTTAGTTGGATGGTGACAAAGATCAATCATTTTC
TTCGAATGGATGACAGTGAAAAAGCTAAAGGTGGACTTCATTTTATTGGCATTCTCGACATTTTCGGGTTTGAAGTGTTTCCAAAAAACTCATTTGAACA
GCTTTGTATAAATTTTGCTAACGAGACTTTACAGCAACAGTTTAACGACTATGTATTTAAAGCTGAACAGCGCGAGTACGAATCGCAGGGTGTTGACTGG
AAATACATTGAGTTCTGCGATAATCAAGACTGCGTTAATCTCATCTCGCAGCGACCAACGGGTATTCTTTCACTTATTGACGAAGAATGTGTCATGCCGA
AAGGAAGTGACACGACATTGGCTTCCAAGCTTTACCGTGCGTGTGACAGCCATCCTCGGTTTGAAGCTTCTCGTATTCAACGTGCGAGTGGTTTATTCAC
AATTGTACACTACGCAGGTCACGTGGAATATTCGTCGGATGGGTTCTTGGAAAAAAataaagacgttcttcaccAAGAGGCAGTGGACATGCTTGcctat
tccacacgagaggACAGCTTTACTCGCATTTTGTGCGAAGGTATAGGCGGCTCAAGGGAGCGCTTAAAGTCATCTCCACGTCAACGTGCACAAACTAGCA
AAAACCGAGGAGCAAGTGTCGGACTCCAGTTTAAAGAGCAGTTGACGACCTTACTGGAAACGCTGCACCGGACTAATCCGCACTACGTTCGATGTTTGAA
GCCTAATGATGTCTGTAAGGCTGGGATTTACGAGCGTGATCGTGTGTTGAATCAGTTGCGGTGCAATGGTGTGATGGAGGCTGTTCGGGTGGCTAGAGCA
GGATATCCAATTCGTCT