Description :
From Genome Similarity Track
Location :
Scaffold_5:945510- 946826
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04604hypothetical protein

Sequence
1316 bases(100 bases per row)
CACAGCACACCGCCGACGAATCTTGCCCAAGTAGTGTTCCCGTACCACACAATCAACGCAGACTGCTCCCAGCTTGCCAGCTCTGGTGGGCGCACGACCT
CGTAGATAGGTTGAGGCACCGTGCTCTCCATGACCACGTCGCCATCAGCCTCGACTGTGTAGACCATCTTGATGTCTTGACTTGACTTGAGTATACCAGA
CTTAGGTATACTACGAACTTAGTCCGAACGTCGGTGCGAACTTAACAGAAAATTGCTACGTGCAACCTTCGTGCAACCTCCAACCGACGACGCGTGATGG
AGGGTCGAAAAACCAAAAAGCGCCTTCAAGAAAAGCACAAAGTTAACTTTGTCGTGAGAACCCGGGGTGTTGCTTGCAAGGCAAGTTGATTAATGAGAAT
TAACTAGAGACTAACTAACCGACCTCTTTGTCCTCTCCTAGCCTCCTCTTATGTAGCCAGCGCTGCCTCCTGAGCAGCGCCGTAAATGTAAAGTCCACGA
GCGCCCAGCTAGCGACCGTAAACAGGAATCGAGTTTGTCCAAGTAGCTTTTGTCGAGTCCGTGTCGGGGTTCAATGCCTTCGTGCCGACGCGTGCAGCGT
CGGCGTGTCTTAATCCAGTCACATCCACGGAGGTTGCGAGGCGCTACTCGTCGAGATCATTGCCATGATCAACCACGGCGACAGCAGTTTGACTCAACCG
TAGCTGACGCCCAACAATTTACCAAGTTTTTTCCGACGTGGCGGCTTGCGAATCGAGTGATATGGCACACTTGGCTTCGATATGGATAAATATAGTGATT
TTTCCGACAGATAGTTCTACAGATTTGCTCCGTTGCTACTCAATTGCAAATATTAGCCTATCATATCGTGTCTCTCCTGAGTTTCAGCCAATGATTTTGT
TTAGGGCTAGGTGTACAGCTTCCGACGCTTTCCGACAAATATTTGTCAAAAGCTCAGCCAAAATATGTATTTCTCGATACAAACATGAAGTCAAAAAAAT
GTTCTGAATATATTCAAACGGTTCTTACAACTAGGCCTAATCCTGAAGTAGGACAGGTAAAAAGGACGTTGGTGGACAGCCATTCGTTGACCACTTTTCA
AAAAGGTAAAAGACACGCACATGAGCCTATCAGCTTTTGTACCAACAAACACGCAAAAGGCACGCGCCACCGCTATCAGCGCGTTCAAGCTAATGCTGGA
GCTTGAGGGTGTTAGTATGGAATTTGTCCACGCTAGCATTCTCAAAGACGATTCTGCCAAACGTCTTGCCGCAGCAATGGATCGATTCGGCTATTATCTT
GCTACAAATGAAGATA